View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4918-Insertion-3 (Length: 71)
Name: NF4918-Insertion-3
Description: NF4918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4918-Insertion-3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 4e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 7 - 68
Target Start/End: Complemental strand, 15356079 - 15356018
Alignment:
| Q |
7 |
acttctgtccggttttatcacattttcttcattgtaatgcaggcttgctcgtcgtcgtaatg |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15356079 |
acttctgtccggttttatcacattttcttcattgtaatgcaggcttgctcgttgtcgtaatg |
15356018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University