View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4918_low_2 (Length: 330)
Name: NF4918_low_2
Description: NF4918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4918_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 16 - 319
Target Start/End: Original strand, 37585784 - 37586091
Alignment:
| Q |
16 |
gcgggttttttgatatttctgnnnnnnncatcttgatgcggcattgtttgattctttatcttgctgcgatgtttgcttagtttagatttacaggtgattt |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37585784 |
gcgggttttttgatatttctgtttttttcatcttgatgcggcattgtttgattctttatcttgttgcgatgtttgcttagtttagatttacaggtgattt |
37585883 |
T |
|
| Q |
116 |
tagattcattgcacattcaatcattttgatatttagtttactttagtgttatcactttttcttgaggtataacaattttatacaattaacacgaacaatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37585884 |
tagattcattgcacattcaatcattttgatatttagtttactttagtgttatcactttttctcgaggtataacaattttatacaattaacacgaacaatc |
37585983 |
T |
|
| Q |
216 |
gtgatatttgaacaccacatcattttctactcattcaacattttattttttatttatctctcttcttatcacatc----acaaatttatacactaatata |
311 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |||| |
|
|
| T |
37585984 |
gtgatatttggacaccacatcatttcctactcattcaacattttattttttatttatctctcttcttatcgcatcacaaacaaatttatacactagtata |
37586083 |
T |
|
| Q |
312 |
gctagtat |
319 |
Q |
| |
|
|||||||| |
|
|
| T |
37586084 |
gctagtat |
37586091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University