View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4919-Insertion-9 (Length: 330)
Name: NF4919-Insertion-9
Description: NF4919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4919-Insertion-9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 7e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 37 - 323
Target Start/End: Original strand, 46916981 - 46917262
Alignment:
| Q |
37 |
ggaagttttggttgtactgaagcacatgcacatggagtgatctgtgcaagg-ttggttcttctctgctctagacgacnnnnnnnnnnnnnnnnnnnnnca |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||| || |
|
|
| T |
46916981 |
ggaagttttggttgtactgaagcacatgcacatggagtgatctgtgcaagggttggttcttctctgctct--aagactagtagagtagtagtagtagtca |
46917078 |
T |
|
| Q |
136 |
ctcattcattcatgtcatgtcatcaacctttacaagaatctctgactatgtcgtcgtcagcctcttcttcatcttcattttc-tatcatcttctttgtac |
234 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46917079 |
ctcattcattcat-tcatgtcatcaacctttacaagaatctctgactatgtcgtcagcctcttcttcttcatcttcattttcctatcatcttctttgtac |
46917177 |
T |
|
| Q |
235 |
ttccgaccgtgttattaccaaatgacgtatccctttctctttttgtttttccacatattccttccatcaccttcttctaatagagattg |
323 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46917178 |
ttccgaccgtgttattaccaaatgacgaatccctttctctttttgtttttccacata----ttccatcaccttcttctaatagagattg |
46917262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University