View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4920-Insertion-14 (Length: 231)
Name: NF4920-Insertion-14
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4920-Insertion-14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 43952018 - 43952186
Alignment:
| Q |
7 |
agtaccttgccaactttagcgacttctaaagaagctttttcgagaatgaatataacactttgtttctcgctattattttcattcaaaggagcaattggaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || || ||||||||||||||||||||||||| |
|
|
| T |
43952018 |
agtaccttgccaactttagcgacttctaaagaagctttttcgagaatgaatataacaccttgtttctcactgttcttttcattcaaaggagcaattggaa |
43952117 |
T |
|
| Q |
107 |
taccaggaagttcagattcctctgttggagcactttgttcatcgttctgaagatttggtttctttggtg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
43952118 |
taccaggaagttcagattcctctgttggcgcacttggttcatcgttatgaagatttggtttcttcggtg |
43952186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 8 - 185
Target Start/End: Complemental strand, 11155070 - 11154878
Alignment:
| Q |
8 |
gtaccttgccaactttagcgacttctaaagaagctttttcgagaatgaatataacactttgtttctcgctattattttcattcaaaggagcaattggaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| | ||||||||||||||||| |
|
|
| T |
11155070 |
gtaccttgccaactttagcgacttctaaagaagctttttcgagaatgaatataacactttgtttctcgttattcttttcacttaaaggagcaattggaat |
11154971 |
T |
|
| Q |
108 |
accaggaagttcagattcctctg---------------ttggagcactttgttcatcgttctgaagatttggtttctttggtgctgcttgaat |
185 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11154970 |
accaggaagttcagattcctctgttgttgttgttgctattggagcactttgttcatcgttctgaagatttggtttctttggtgctgcttgaat |
11154878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University