View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4920-Insertion-3 (Length: 811)
Name: NF4920-Insertion-3
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4920-Insertion-3 |
 |  |
|
| [»] chr2 (178 HSPs) |
 |  |
|
| [»] chr4 (212 HSPs) |
 |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (2 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (2 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0085 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0011 (3 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0562 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 647; Significance: 0; HSPs: 178)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 647; E-Value: 0
Query Start/End: Original strand, 8 - 811
Target Start/End: Original strand, 32475608 - 32476419
Alignment:
| Q |
8 |
cttatatctctgtggttgagttgactgttgattagatctacatgattcttcaaacttgagagtgtcacatcatttcagacccttaacatatattgtttcc |
107 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32475608 |
cttatgtctctgtgattgagttgactgttgattagatctacatgattcttcaaacttgagagcgtcgcatcatttcagacccttaacatatattgtttcc |
32475707 |
T |
 |
| Q |
108 |
cccgttgtggtatatttcacttagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagcta |
207 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32475708 |
tccattgtggtatatttcacttagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgaaaacatacaagcta |
32475807 |
T |
 |
| Q |
208 |
atttatagaagattatgtgtgtcgtggatcacaaaatatgtcggtgcaagacgaacatagaaaaaatcatgaactgaatagtttcaaattatataatttg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32475808 |
atttatagaagattatgtgtgtcgtggaccacaaaatatgtcggtgcaagacgaacatagaaaaaatcatgaactgaatagtttcaaattatataatttg |
32475907 |
T |
 |
| Q |
308 |
agccctccctcaccatataaagtaagaattttaacag---tcttgaaccagttcagattatataatccaaacatttcttggtcatgttcggataatatca |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32475908 |
agccctccctcaccatataaagtaagaattttaacagtactcttgaaccagttcatattatataatccaaacatttcttggtcgtgttcggataatatca |
32476007 |
T |
 |
| Q |
405 |
ttcgaaatagttcagagtttcgatggttacttgttcagcaagagtaacttattgaacatgtttttctttggattttaccagttttaaggctaaaatatgg |
504 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
32476008 |
ttcgaaatagttcaaagtttcgatggttacttgctcagcaagagtaacttattgaacatgtttttctttggtttttaccagtttcaaggctaaaatatgg |
32476107 |
T |
 |
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttgatccgttttacattcc |
604 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||| || ||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
32476108 |
ttttgatccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttaattcgttttacattcc |
32476207 |
T |
 |
| Q |
605 |
ttggtttcttcttcctcattagagattggtggtggtgagtaggtgacttcttttgcggagaggaagagagacgaaggagtatggtgtggggtgtatgtgt |
704 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||| ||||||||||||||||||||||||||| |
|
|
| T |
32476208 |
ttggtttcttcttcctcattagagattggtggtggtgagtaggtgacttcttttgtggagagggagggagacaaaggagtatggtgtggggtgtatgtgt |
32476307 |
T |
 |
| Q |
705 |
gtctgagtgagagaga-----gtggtgcggtgtgttagttttccaacttttggcattttttcgtcgaaattctttgaacgagagattctatcatttgact |
799 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32476308 |
gtctgagtgagagagaatggtgtggtgtggtgtgttagttttccaacttttggcatttttttctcgaaattctttgaacgagagattctatcatttgact |
32476407 |
T |
 |
| Q |
800 |
ttgaacttcctt |
811 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32476408 |
ttgaacttcctt |
32476419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 585 - 732
Target Start/End: Original strand, 39923732 - 39923881
Alignment:
| Q |
585 |
tttgatccgttttacattccttggtttcttcttcctcattagagattggtggtggtgagtaggtgacttcttttgcggagaggaagagagacgaagga-- |
682 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || | ||||||||||| | |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
39923732 |
tttgatccgttttacattccttggtttcttcttcctcattaaaggtaggtggtggtgactcggtgacttattttgcggagagggagagagacgaaggagt |
39923831 |
T |
 |
| Q |
683 |
--gtatggtgtggggtgtatgtgtgtctgagtgagagagagtggtgcggtgt |
732 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||||| ||||| ||||| |
|
|
| T |
39923832 |
atgtatggtgtggggtgtatttgtgtat--gtgagagagaatggtgtggtgt |
39923881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 29859878 - 29859776
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
29859878 |
ttttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaatttttgttgtttttggtccctgcaaaatatt |
29859779 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
29859778 |
ttg |
29859776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 487 - 585
Target Start/End: Complemental strand, 2481562 - 2481464
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
2481562 |
tttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
2481464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 488 - 588
Target Start/End: Complemental strand, 15842827 - 15842727
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
15842827 |
ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatatttt |
15842728 |
T |
 |
| Q |
588 |
g |
588 |
Q |
| |
|
| |
|
|
| T |
15842727 |
g |
15842727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 491 - 590
Target Start/End: Complemental strand, 16523326 - 16523227
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttgat |
590 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||| ||||||||||||||| |
|
|
| T |
16523326 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgat |
16523227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 14003744 - 14003646
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
14003744 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattttg |
14003646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 25705083 - 25705181
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
25705083 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
25705181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 33575746 - 33575848
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
33575746 |
tttttaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatt |
33575845 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
33575846 |
ttg |
33575848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 1138360 - 1138263
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1138360 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaattttttgttgttgtttttggtccctgcaaaatattttg |
1138263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 487 - 580
Target Start/End: Original strand, 4423890 - 4423983
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
4423890 |
tttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
4423983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 13215059 - 13215156
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
13215059 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttg |
13215156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 24358615 - 24358712
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
24358615 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatattttg |
24358712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 490 - 582
Target Start/End: Original strand, 4042608 - 4042699
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat |
582 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||| |
|
|
| T |
4042608 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag-tcctgtaaattttttttgttgtttttggtccctgcaaaat |
4042699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 20131681 - 20131585
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
20131585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 24358947 - 24358890
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24358947 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 493 - 588
Target Start/End: Complemental strand, 42696202 - 42696107
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||| || ||||||||| |||||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccatgtaaaaaaaatttgttgtttttgatccctgcaaaatattttg |
42696107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 16522988 - 16523047
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16522988 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
16523047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 40125295 - 40125193
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| |||| |||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
40125295 |
ttttaaggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
40125196 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
40125195 |
ttg |
40125193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 8046327 - 8046385
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8046327 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt |
8046385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 146690 - 146594
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
146594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 587
Target Start/End: Complemental strand, 16673772 - 16673676
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
16673772 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatttt |
16673676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 33732857 - 33732918
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33732857 |
tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33732918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 580
Target Start/End: Original strand, 40124966 - 40125054
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgtaatttttttttgttgtttttggtccctgcaaa |
40125054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 489 - 580
Target Start/End: Original strand, 18113086 - 18113177
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
18113086 |
taaggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
18113177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 22881607 - 22881663
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22881607 |
ttttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22881663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 25705450 - 25705394
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25705450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 489 - 580
Target Start/End: Complemental strand, 36815838 - 36815747
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
36815838 |
taaggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgtaatttttttttgttgtttttggtccctgcaaa |
36815747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 5335040 - 5334985
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 10374775 - 10374830
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
10374830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 487 - 542
Target Start/End: Complemental strand, 17541781 - 17541726
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
17541781 |
tttaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
17541726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 43672320 - 43672222
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| | |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43672320 |
aaggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaaaaattttttattgtttttggtccctgcaaaatattttg |
43672222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 4424187 - 4424129
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
4424187 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
4424129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 485 - 547
Target Start/End: Original strand, 14003402 - 14003464
Alignment:
| Q |
485 |
gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
14003402 |
gtttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 16900209 - 16900151
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16900209 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16900151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 16993600 - 16993542
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16993600 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16993542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 24483893 - 24483835
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24483893 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
24483835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 37272105 - 37272047
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37272105 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 11788417 - 11788321
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
11788417 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt-aattttttttgttgtttttggtccctgcaaaatattttg |
11788321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 19184153 - 19184096
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19184153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 20131311 - 20131372
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
20131311 |
tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 26814231 - 26814174
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26814231 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 494 - 587
Target Start/End: Complemental strand, 29182440 - 29182348
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtttctgt-aaaaaaaattgttgtttttggtccctgcaaaatatttt |
29182348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 30215420 - 30215477
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
30215420 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 485 - 542
Target Start/End: Original strand, 31644834 - 31644891
Alignment:
| Q |
485 |
gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
31644834 |
gtttaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
31644891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 33576119 - 33576062
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
33576119 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 580
Target Start/End: Original strand, 34317798 - 34317886
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa |
34317886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 37271737 - 37271794
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37271737 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 37910755 - 37910851
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||| |||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
37910755 |
aggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatattttg |
37910851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 38980255 - 38980198
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38980255 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 43671929 - 43671990
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
43671929 |
tttaaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgt |
43671990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 44559061 - 44559118
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
44559061 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
44559118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 44985985 - 44985928
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
44985985 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
44985928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 9195054 - 9195110
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
9195110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 20939329 - 20939269
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
20939329 |
ttaacgctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
20939269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 488 - 540
Target Start/End: Complemental strand, 37911124 - 37911072
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
37911124 |
ttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
37911072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 41451836 - 41451892
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
41451836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 487 - 547
Target Start/End: Complemental strand, 44073812 - 44073752
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
44073812 |
tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 11713847 - 11713749
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
11713847 |
aaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaataattttgtttttggtccctgcaaaattttttg |
11713749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 582
Target Start/End: Original strand, 23732039 - 23732129
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat |
582 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| | ||| || |||||||||||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaaat |
23732129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 38731826 - 38731885
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38731826 |
taaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
38731885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 40301973 - 40302071
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||| |||||||| ||||| | |||||||||||||||||||||||||||| |
|
|
| T |
40301973 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattttg |
40302071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 43788857 - 43788908
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43788857 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
43788908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 1137983 - 1138037
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgt |
1138037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 580
Target Start/End: Original strand, 10671629 - 10671718
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
10671629 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaa |
10671718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 17302145 - 17302087
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
17302145 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
17302087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 27109073 - 27109123
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt |
27109123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 31225713 - 31225771
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31225713 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgt |
31225771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 36815487 - 36815584
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| | ||| ||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
36815487 |
aggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
36815584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 40302340 - 40302243
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
40302340 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgtaaacaaaaaattttgtttttggtccctgcaaaattttttg |
40302243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 42358697 - 42358755
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42358697 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
42358755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 42695868 - 42695918
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
42695918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 44985623 - 44985677
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
44985677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 9195207 - 9195150
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9195207 |
aggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgt |
9195150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 16673409 - 16673466
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
16673409 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 17541380 - 17541437
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
17541380 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 19183780 - 19183837
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19183780 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 26707872 - 26707929
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
26707872 |
aggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgt |
26707929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 35686335 - 35686282
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
35686335 |
taaaatatggttttgatccctgtaaatatgcttcgttttggttttagtttctgt |
35686282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 496 - 588
Target Start/End: Complemental strand, 36806892 - 36806800
Alignment:
| Q |
496 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || || ||||||||||||| ||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttatttttggtccctgtaaaatattttg |
36806800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 43592045 - 43592102
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
43592045 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
43592102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 43597153 - 43597210
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43597153 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt |
43597210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 486 - 547
Target Start/End: Complemental strand, 43789198 - 43789137
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||| |||||||||||||||| |||| |
|
|
| T |
43789198 |
ttttaaggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 3172018 - 3172070
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
3172018 |
aaggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagt |
3172070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 3172534 - 3172482
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
3172534 |
aaggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagt |
3172482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 3671192 - 3671136
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3671136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 493 - 588
Target Start/End: Complemental strand, 3838263 - 3838168
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaattttttg |
3838168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 8046648 - 8046592
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
8046592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 11713485 - 11713541
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
11713541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 587
Target Start/End: Complemental strand, 18113454 - 18113359
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||| | ||||| || |||||||| |||||||||||||||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgtaaattttttttgttgtttttagtccctgcaaaatatttt |
18113359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 538
Target Start/End: Complemental strand, 23732330 - 23732282
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
23732330 |
aaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
23732282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 23989832 - 23989888
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23989832 |
tttttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
23989888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 538
Target Start/End: Original strand, 27310874 - 27310922
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27310874 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 538
Target Start/End: Original strand, 29831812 - 29831860
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29831812 |
aaggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 31226077 - 31226029
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggtttta |
31226029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 33733241 - 33733193
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 36622250 - 36622306
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
36622306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 37228731 - 37228783
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
37228731 |
aaggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagt |
37228783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 41694003 - 41693947
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
41693947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 44559407 - 44559359
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
44559359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 44994063 - 44994011
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
44994063 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagt |
44994011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 494 - 588
Target Start/End: Complemental strand, 1497943 - 1497849
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||| |||| || |||||||||||||||||||||| ||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctgcagaactttttttttgtttttggtccctgcaaaattttttg |
1497849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 5790558 - 5790613
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 485 - 548
Target Start/End: Complemental strand, 7814744 - 7814681
Alignment:
| Q |
485 |
gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||| ||||||||||||| |||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
7814744 |
gtttttaggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
7814681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 10671942 - 10671891
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
10671942 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
10671891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 26813866 - 26813921
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 27311070 - 27311019
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
27311070 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagt |
27311019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 29865222 - 29865277
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29865277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 30215872 - 30215774
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | ||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
30215872 |
aggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
30215774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 31326254 - 31326156
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||||||||||||| |||||||| ||||| || |||||||||||||||||||||| ||||| |
|
|
| T |
31326254 |
aaggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaaaataaaatttttgtttttggtccctgcaaaattttttg |
31326156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 31909479 - 31909429
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
31909479 |
aggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagt |
31909429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 38639411 - 38639462
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
38639411 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
38639462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 39367762 - 39367664
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| | ||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
39367762 |
aaggctaaaatatggtcttgatccctgtaaatatgctttattttggttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
39367664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 4042890 - 4042840
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagt |
4042840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 10665296 - 10665238
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| ||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
10665296 |
aaggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgt |
10665238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 34318083 - 34318033
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| ||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagt |
34318033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 36622582 - 36622528
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtttctgt |
36622528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 40786454 - 40786516
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
40786454 |
tttttaggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgt |
40786516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 41693672 - 41693730
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
41693672 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
41693730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 1295544 - 1295491
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgt |
1295491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 2481191 - 2481248
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||| ||||||||||||||||| |||| |
|
|
| T |
2481191 |
aaggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 3671002 - 3671059
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
3671002 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt |
3671059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 7814244 - 7814301
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
7814244 |
aaggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 12835325 - 12835421
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| ||||||||||||| ||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtctctgcaaaatattttg |
12835421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 13850521 - 13850578
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
13850521 |
aggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgt |
13850578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 20658060 - 20658117
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
20658060 |
aggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
20658117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 29865512 - 29865455
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
29865512 |
aggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgt |
29865455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 492 - 541
Target Start/End: Complemental strand, 34964159 - 34964110
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttag |
34964110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 43710713 - 43710652
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
43710713 |
tttaaggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgt |
43710652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 1497610 - 1497666
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt |
1497666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 2265401 - 2265341
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
2265401 |
ttaaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgt |
2265341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 10375069 - 10375021
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10375021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 539
Target Start/End: Complemental strand, 13215366 - 13215318
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
13215366 |
aggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 488 - 548
Target Start/End: Original strand, 16968548 - 16968608
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
16968548 |
ttaaggttaaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgt |
16968608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 539
Target Start/End: Complemental strand, 20658410 - 20658362
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
20658410 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 26239161 - 26239105
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
26239161 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 38231431 - 38231487
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| |||||| ||||||| ||||| |
|
|
| T |
38231431 |
ggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgt |
38231487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 43597503 - 43597443
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
43597503 |
ttaaggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt |
43597443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 3832634 - 3832587
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagt |
3832587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 13850881 - 13850834
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagt |
13850834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 17912808 - 17912761
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
17912761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 24483401 - 24483456
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgt |
24483456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 25954429 - 25954370
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
25954429 |
taaggttaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt |
25954370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 487 - 542
Target Start/End: Complemental strand, 38231826 - 38231771
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||| ||||||||| ||||||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
38231826 |
tttaaggttaaaatatgattttgatccctccaaatatgcttcgttttgattttagt |
38231771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 3837931 - 3837989
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
3837931 |
aaggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgt |
3837989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 5006605 - 5006663
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||| |||||||||||||||||| |||| |
|
|
| T |
5006605 |
aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagtttctgt |
5006663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 26238811 - 26238869
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
26238811 |
aaggttaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
26238869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 35155621 - 35155563
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| || |||||| ||||||| ||||| |
|
|
| T |
35155621 |
aaggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgt |
35155563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 41791020 - 41791074
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt |
41791074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 538
Target Start/End: Complemental strand, 41791312 - 41791266
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
41791266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 497 - 542
Target Start/End: Complemental strand, 4794468 - 4794423
Alignment:
| Q |
497 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagt |
4794423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 4842865 - 4842914
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagt |
4842914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 10664983 - 10665040
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| | ||||| ||||| |
|
|
| T |
10664983 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgt |
10665040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 19831503 - 19831564
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||| |||||||||||||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
19831503 |
tttaaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt |
19831564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 32691312 - 32691361
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
32691312 |
aggctaaaatatggttttagtttctgcaaatatgcctcgttttggtttta |
32691361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 489 - 542
Target Start/End: Complemental strand, 45442699 - 45442646
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| |||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
45442699 |
taaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagt |
45442646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 494 - 546
Target Start/End: Complemental strand, 25300038 - 25299987
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct |
546 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagttcct |
25299987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 25954113 - 25954165
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
25954113 |
aaggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagt |
25954165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 31325920 - 31325976
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgt |
31325976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 498 - 542
Target Start/End: Original strand, 35155298 - 35155342
Alignment:
| Q |
498 |
aatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagt |
35155342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 495 - 543
Target Start/End: Complemental strand, 37229039 - 37228991
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt |
543 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagtt |
37228991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 17912452 - 17912499
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
17912499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 23990193 - 23990146
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
23990146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 14393132 - 14393079
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| ||| | ||| |||||||||| ||||||||||||||||| |
|
|
| T |
14393132 |
ttaaggctaaaatatgatttagttcc-tgcaaatatgtctcgttttggttttagt |
14393079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 25299747 - 25299801
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgt |
25299801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29831885 |
ttttggtccctgcaaatatgcctcgttttggtttt |
29831919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 487 - 540
Target Start/End: Original strand, 13802481 - 13802534
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||||||| | | || |||||| |||||||||||||||| |
|
|
| T |
13802481 |
tttaaggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta |
13802534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 540
Target Start/End: Complemental strand, 16900129 - 16900100
Alignment:
| Q |
511 |
tccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16900129 |
tccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 540
Target Start/End: Complemental strand, 16993520 - 16993491
Alignment:
| Q |
511 |
tccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16993520 |
tccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 548
Target Start/End: Complemental strand, 22881949 - 22881912
Alignment:
| Q |
511 |
tccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
22881949 |
tccctgcaaatatgtctcgttttggttttagtccctgt |
22881912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 34963796 - 34963845
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||||||| |||||| | |||||| ||||||| |
|
|
| T |
34963796 |
gctaaaatatggttttgatccctgctaatatgttttgttttgattttagt |
34963845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 76; Significance: 1e-34; HSPs: 165)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 589 - 721
Target Start/End: Complemental strand, 2059361 - 2059225
Alignment:
| Q |
589 |
atccgttttacattccttggtttcttcttcctcattagagattggtggtggtgagtaggtgacttcttttgcggagaggaagagagacgaaggagt---- |
684 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || | |||||||||| ||||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
2059361 |
atccgttttacattccttggtttcttcttcctcattagaggttagcggtggtgagtcagtgacttcttttgcggagaaggagagtgacgaaggagtatgc |
2059262 |
T |
 |
| Q |
685 |
atggtgtggggtgtatgtgtgtctgagtgagagagag |
721 |
Q |
| |
|
|||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
2059261 |
atggtgtggggtgtatttgtgtgtgtgtgagagagag |
2059225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 490 - 585
Target Start/End: Complemental strand, 19685382 - 19685287
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
19685382 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
19685287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 1381245 - 1381343
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1381245 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
1381343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 491 - 585
Target Start/End: Complemental strand, 24443745 - 24443651
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
24443745 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
24443651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 40764782 - 40764684
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
40764782 |
aaggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
40764684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 28872000 - 28871938
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28872000 |
ttttaaggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt |
28871938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 488 - 584
Target Start/End: Complemental strand, 5917464 - 5917368
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat |
584 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
5917464 |
ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatat |
5917368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 35928458 - 35928362
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
35928362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 485 - 588
Target Start/End: Original strand, 29692737 - 29692840
Alignment:
| Q |
485 |
gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat |
584 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
29692737 |
gtttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaagttttgtttttggtccctgcaaaatat |
29692836 |
T |
 |
| Q |
585 |
tttg |
588 |
Q |
| |
|
|||| |
|
|
| T |
29692837 |
tttg |
29692840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 487 - 547
Target Start/End: Original strand, 40764410 - 40764470
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40764410 |
tttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 488 - 547
Target Start/End: Complemental strand, 1381615 - 1381556
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1381615 |
ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 5614536 - 5614434
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| || |
|
|
| T |
5614536 |
tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaatttt |
5614437 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
5614436 |
ttg |
5614434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 19565465 - 19565563
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
19565465 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg |
19565563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 20986091 - 20985993
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
20986091 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
20985993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 491 - 585
Target Start/End: Original strand, 37271358 - 37271452
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
37271358 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
37271452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 5917125 - 5917222
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
5917125 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
5917222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 35877053 - 35876956
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
35877053 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
35876956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 38170512 - 38170570
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38170512 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
38170570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 30888160 - 30888256
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||| ||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtagaattttttttttgtttttggtccctgcaaaattttttg |
30888256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 35928062 - 35928119
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35928062 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 485 - 588
Target Start/End: Original strand, 45131 - 45234
Alignment:
| Q |
485 |
gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat |
584 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||| ||| |||||||||| |
|
|
| T |
45131 |
gttttatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttgatccttgcaaaatat |
45230 |
T |
 |
| Q |
585 |
tttg |
588 |
Q |
| |
|
|||| |
|
|
| T |
45231 |
tttg |
45234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 582
Target Start/End: Original strand, 1104857 - 1104948
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat |
582 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
1104857 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaat |
1104948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 1105149 - 1105093
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1105149 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 493 - 588
Target Start/End: Complemental strand, 2636992 - 2636898
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttag-tcctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg |
2636898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 19565832 - 19565776
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19565832 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 20660946 - 20660998
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20660946 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
20660998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 2217492 - 2217590
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
2217492 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttg |
2217590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 6912497 - 6912552
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 18258529 - 18258431
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| | ||| || |||||||||||||| ||||||||||||| |
|
|
| T |
18258529 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccccgcaaaatattttg |
18258431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 26071618 - 26071521
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
26071618 |
aaggttaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgtaatttttgttt-ttgtttttggtccctgcaaaatattttg |
26071521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 4203452 - 4203506
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4203452 |
ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 5904007 - 5904104
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||| ||||||| ||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
5904007 |
aggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgtaaattatttttgttgtttttgatccctgcaaaatattttg |
5904104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 5950170 - 5950232
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5950170 |
tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
5950232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 494 - 587
Target Start/End: Complemental strand, 6912855 - 6912762
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccatgcaaaatatttt |
6912762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 7075570 - 7075628
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7075570 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
7075628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 492 - 585
Target Start/End: Complemental strand, 20661311 - 20661218
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatatt |
20661218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 21124911 - 21124969
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
21124911 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
21124969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 24443377 - 24443435
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
24443377 |
taaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 28863508 - 28863566
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28863508 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28863566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 29151854 - 29151796
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29151854 |
taaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg |
29151796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 29172889 - 29172831
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29172889 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 29875397 - 29875455
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29875397 |
taaggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg |
29875455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 36578085 - 36578027
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36578085 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
36578027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 4736547 - 4736486
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
4736547 |
tttaaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgt |
4736486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 18633597 - 18633654
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18633597 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Complemental strand, 29875731 - 29875670
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29875731 |
tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 30800493 - 30800550
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30800493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30800550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 30800851 - 30800794
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30800851 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30800794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 35167167 - 35167110
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35167167 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 35876686 - 35876743
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
35876686 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 36973710 - 36973614
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||| ||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
36973614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 40038493 - 40038542
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40038493 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 40038858 - 40038762
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| |||||||||||| | ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
40038762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 42596448 - 42596509
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
42596448 |
tttaaggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctgt |
42596509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 10743722 - 10743774
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10743722 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10743774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 16038375 - 16038427
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16038375 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
16038427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 19685016 - 19685072
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19685016 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 28213371 - 28213423
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
28213371 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
28213423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 28550827 - 28550883
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28550883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 28863838 - 28863782
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28863782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 29366949 - 29366893
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
29366893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 494 - 546
Target Start/End: Complemental strand, 35609635 - 35609583
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct |
546 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcct |
35609583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 40029497 - 40029441
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
40029441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 2217855 - 2217804
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
2217804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 487 - 542
Target Start/End: Complemental strand, 13990900 - 13990845
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13990900 |
tttaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
13990845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 18046349 - 18046298
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18046349 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18046298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 20690732 - 20690783
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
20690732 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
20690783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 15635710 - 15635652
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
15635710 |
taaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 18258159 - 18258217
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
18258159 |
taaggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 26133415 - 26133357
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
26133415 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
26133357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 493 - 547
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 487 - 541
Target Start/End: Original strand, 35166906 - 35166960
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
35166906 |
tttaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 38786157 - 38786215
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
38786157 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
38786215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 40167784 - 40167842
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40167784 |
aaggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
40167842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 1286682 - 1286778
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||||||||||||| ||||| || ||||||||| || ||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttgatctctgcaaaatattttg |
1286778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 10408926 - 10408983
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
10408926 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 10830528 - 10830585
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||| |||||||||||||||||||| |
|
|
| T |
10830528 |
aggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgt |
10830585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 11799459 - 11799402
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgt |
11799402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 23381949 - 23382006
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23381949 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt |
23382006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 540
Target Start/End: Complemental strand, 25562000 - 25561951
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25562000 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 25779163 - 25779106
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
25779163 |
aggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgt |
25779106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 26133178 - 26133239
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
26133178 |
tttatggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
26133239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 28108159 - 28108106
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgt |
28108106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 36577721 - 36577778
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
36577721 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
36577778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 37271708 - 37271651
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
37271708 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 293826 - 293878
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
293826 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
293878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 6118499 - 6118451
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6118451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 10409332 - 10409276
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
10409332 |
tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
10409276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 18633961 - 18633913
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 27916766 - 27916714
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27916766 |
aaggttaaaatatggttttattccctgcaaatatgcctcgttttggttttagt |
27916714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 33336026 - 33335970
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt |
33335970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 34125301 - 34125357
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34125301 |
tttttaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
34125357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 35609303 - 35609359
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgt |
35609359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 38554750 - 38554799
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38554750 |
aggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagt |
38554799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 18286744 - 18286685
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
18286744 |
taaggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagttactgt |
18286685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 25561705 - 25561760
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 34125635 - 34125576
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
34125635 |
taaggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt |
34125576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 39379611 - 39379560
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
39379611 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
39379560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 1287047 - 1286989
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
1287047 |
aaggttaaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgt |
1286989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 2636669 - 2636719
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagt |
2636719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 540
Target Start/End: Complemental strand, 9179922 - 9179872
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
9179922 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 584
Target Start/End: Original strand, 12144906 - 12144998
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat |
584 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| ||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
12144906 |
aggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgtatttttttgtt-ttgtttttggtccctgcaaaatat |
12144998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 18046036 - 18046094
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
18046036 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
18046094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 20683741 - 20683803
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
20683741 |
ttttaaggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgt |
20683803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 23382297 - 23382247
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
23382247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 537
Target Start/End: Original strand, 31602142 - 31602188
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt |
537 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
31602142 |
aggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt |
31602188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 38496785 - 38496727
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
38496785 |
taaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 42553642 - 42553692
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
42553692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 4203771 - 4203714
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
4203771 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
4203714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 10744055 - 10743998
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
10744055 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt |
10743998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 11799127 - 11799184
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
11799127 |
aaggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 24781988 - 24782045
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
24781988 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24782045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 193
Target Start/End: Complemental strand, 26204297 - 26204180
Alignment:
| Q |
76 |
atcatttcagacccttaacatatattgtttcccccgttgtggtatatttcacttagtttggtgttcagatcaatgcccgaggtgtccatgattatttggt |
175 |
Q |
| |
|
||||||||| ||||| ||||||| ||||||| | |||| ||| | | || ||||||||||||||||||||||| || ||| | ||||||||||||| |
|
|
| T |
26204297 |
atcatttcaaaccctaaacatattgggtttccctcattgtagtaaactacaattagtttggtgttcagatcaatgattgaagtgcctatgattatttggt |
26204198 |
T |
 |
| Q |
176 |
gtggtttaaaacatatga |
193 |
Q |
| |
|
|||||||| |||| |||| |
|
|
| T |
26204197 |
gtggtttacaacaaatga |
26204180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 540
Target Start/End: Complemental strand, 31037742 - 31037693
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31037742 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 496 - 580
Target Start/End: Original strand, 32888691 - 32888775
Alignment:
| Q |
496 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgtaatttttttttgttgtttttggtccctgcaaa |
32888775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 492 - 580
Target Start/End: Original strand, 36973353 - 36973441
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagttcatgtaaaaaatatttgttgtttttggtccctgcaaa |
36973441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 487 - 540
Target Start/End: Original strand, 40029136 - 40029189
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
40029136 |
tttaaggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
40029189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 42596814 - 42596761
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt |
42596761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 3850600 - 3850544
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3850600 |
aggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 5104001 - 5103945
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagtttctgt |
5103945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 5614164 - 5614216
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
5614164 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
5614216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 9532537 - 9532485
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
9532537 |
aaggttaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
9532485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 14318039 - 14318095
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
14318039 |
tttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
14318095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 16038738 - 16038690
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
16038690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 21050913 - 21050857
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgt |
21050857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 29693092 - 29693040
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
29693092 |
aaggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt |
29693040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 36278075 - 36278131
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| || |||| |||||||| |
|
|
| T |
36278075 |
tttttaggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagt |
36278131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 544
Target Start/End: Original strand, 38962806 - 38962858
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttc |
38962858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 539
Target Start/End: Original strand, 3850299 - 3850346
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 29151516 - 29151571
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
29151571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 38555084 - 38555034
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| ||||||||||||| |
|
|
| T |
38555084 |
aggctaaaatatggtttgg-tccctgcaaatatgcctcattttggttttagt |
38555034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 2032940 - 2032890
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||| ||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagt |
2032890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 15916286 - 15916336
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagt |
15916336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 532
Target Start/End: Original strand, 17070533 - 17070575
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttt |
532 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
17070533 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttt |
17070575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 488 - 538
Target Start/End: Original strand, 20416356 - 20416406
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
20416356 |
ttaaggctaaaatatggttttcgtccctgcaaatatgtctcgctttggttt |
20416406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 540
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 546
Target Start/End: Original strand, 42994068 - 42994122
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct |
546 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgattttaattcct |
42994122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 540
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 9179592 - 9179649
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||| ||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgt |
9179649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 494 - 539
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 15635370 - 15635431
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||| |||||||||||||| ||| |||||||||| || |||||||||||||| |||| |
|
|
| T |
15635370 |
ttttaaggataaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg |
15635431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 26071290 - 26071347
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgt |
26071347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 28871640 - 28871693
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||| ||||| ||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgt |
28871693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 32108807 - 32108856
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
32108807 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttagtttta |
32108856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 40168009 - 40167952
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
40168009 |
aggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgt |
40167952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 42207241 - 42207298
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||| || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
42207241 |
aggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgt |
42207298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 494 - 542
Target Start/End: Original strand, 16616370 - 16616418
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagt |
16616418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 20691094 - 20691046
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||| ||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagt |
20691046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 35166159 - 35166103
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||| ||||||||||| |||||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
35166159 |
aggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg |
35166103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 538
Target Start/End: Complemental strand, 38182089 - 38182041
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38182089 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 538
Target Start/End: Original strand, 38189042 - 38189090
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38189042 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 538
Target Start/End: Complemental strand, 38209315 - 38209267
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38209315 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 538
Target Start/End: Original strand, 38216267 - 38216315
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
38216267 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 42207576 - 42207517
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||| ||||||||||||||| ||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
42207576 |
ttaagcctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctgt |
42207517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 29855614 - 29855669
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||| ||||| ||| || ||||||||||| ||||||||||||| ||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgt |
29855669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 487 - 542
Target Start/End: Original strand, 31037390 - 31037445
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||| ||| |||||| ||||||| |
|
|
| T |
31037390 |
tttaagactaaaatatggttttagtccctgcaaatataccttgttttgattttagt |
31037445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 766 - 811
Target Start/End: Complemental strand, 2059167 - 2059124
Alignment:
| Q |
766 |
aaattctttgaacgagagattctatcatttgactttgaacttcctt |
811 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
2059167 |
aaattctttgaacgaga--ttctatcatttgcctttgaacttcctt |
2059124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 9588611 - 9588561
Alignment:
| Q |
493 |
gctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||| |||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagt |
9588561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 491 - 541
Target Start/End: Complemental strand, 17070864 - 17070814
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||| ||||||| |
|
|
| T |
17070864 |
aggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag |
17070814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 28213446 - 28213480
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28213446 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28213480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 3851330 - 3851273
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||| ||||||| ||||| |
|
|
| T |
3851330 |
aggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgt |
3851273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 536
Target Start/End: Original strand, 4736204 - 4736249
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
536 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
4736204 |
aggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 505 - 542
Target Start/End: Original strand, 31602221 - 31602258
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagt |
31602258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 62; Significance: 2e-26; HSPs: 212)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 592 - 811
Target Start/End: Original strand, 6486478 - 6486701
Alignment:
| Q |
592 |
cgttttacattccttggtttcttcttcctc---attagagattggtggtggtgagtaggtgacttcttttgcggagaggaagagagacgaaggagt---- |
684 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||||| ||||||||||||||| |||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
6486478 |
cgttttacattcctaggtttcttcttcttcttcattagaggttggtggtggtgagtcggtgacttcttttgtggagagggagagagacaaaggagtatgc |
6486577 |
T |
 |
| Q |
685 |
atggtgtggg-gtgtatgtgtgtctgagtgagagagagtggtgcggtgtgttagttttccaacttttggcattttttcgtcgaaattctttgaacgagag |
783 |
Q |
| |
|
|||||||||| || | ||||||| ||||||| ||||| | ||| |||||||| |||| | ||||||||||||||| | ||||||||||||| || |
|
|
| T |
6486578 |
atggtgtgggtgtatttgtgtgtgtgagtgacagagaatagtgtggtgtgtt-gtttccttgcttttggcatttttt-tcccaaattctttgaac--aag |
6486673 |
T |
 |
| Q |
784 |
attctatcatttgactttgaacttcctt |
811 |
Q |
| |
|
||||||| ||||| ||||||| |||||| |
|
|
| T |
6486674 |
attctataatttgcctttgaatttcctt |
6486701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 13530715 - 13530617
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
13530715 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
13530617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 24774043 - 24774141
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
24774043 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttattgtttttggtccttgcaaaatattttg |
24774141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 25423918 - 25424020
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
25423918 |
ttttaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
25424017 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
25424018 |
ttg |
25424020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 43231391 - 43231293
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
43231391 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
43231293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 485 - 588
Target Start/End: Complemental strand, 23779232 - 23779129
Alignment:
| Q |
485 |
gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat |
584 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
23779232 |
gttttaaggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgtcaattttttttgttgtttttggtccctgcaaaatat |
23779133 |
T |
 |
| Q |
585 |
tttg |
588 |
Q |
| |
|
|||| |
|
|
| T |
23779132 |
tttg |
23779129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 29499180 - 29499278
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
29499180 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
29499278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 30046794 - 30046696
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
30046794 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
30046696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 30061135 - 30061037
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
30061135 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
30061037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 35464012 - 35464114
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
35464012 |
tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
35464111 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
35464112 |
ttg |
35464114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 13631227 - 13631324
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
13631227 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
13631324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 14487801 - 14487898
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
14487801 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
14487898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 23245596 - 23245499
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
23245596 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttg |
23245499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 53916048 - 53915951
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
53916048 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattttg |
53915951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 46115414 - 46115510
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg |
46115510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 46128548 - 46128644
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg |
46128644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 580
Target Start/End: Complemental strand, 2322434 - 2322344
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
2322434 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgtaaattgtttttgttgtttttggtccctgcaaa |
2322344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 45505896 - 45505838
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45505896 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 31560329 - 31560386
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
31560329 |
aaggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 31560695 - 31560599
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
31560599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 31811920 - 31811981
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
31811920 |
tttaaggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgt |
31811981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 32365093 - 32365150
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32365093 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
32365150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 488 - 588
Target Start/End: Original strand, 50753918 - 50754018
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||| || |||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
50753918 |
ttaaggttaaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgtaaatttcttttgttgtttttggtccctgcaaaatatttt |
50754017 |
T |
 |
| Q |
588 |
g |
588 |
Q |
| |
|
| |
|
|
| T |
50754018 |
g |
50754018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 493 - 588
Target Start/End: Original strand, 2322094 - 2322189
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgtaaaaaatttttgttgtttttggtccctgcagaatattttg |
2322189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 18205150 - 18205206
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18205150 |
ttttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18205206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 26412189 - 26412245
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26412189 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 41324890 - 41324834
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgt |
41324834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 44925483 - 44925535
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44925483 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
44925535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 494 - 588
Target Start/End: Complemental strand, 19903653 - 19903559
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||| | ||| || |||||||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaaatattttg |
19903559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 23245231 - 23245286
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 580
Target Start/End: Complemental strand, 25424314 - 25424224
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
25424314 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
25424224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 35464382 - 35464327
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 42848025 - 42848123
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||||||| ||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
42848025 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttg |
42848123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 42848391 - 42848336
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 52017502 - 52017561
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52017502 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
52017561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 52017873 - 52017814
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52017873 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
52017814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 54903478 - 54903419
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
54903478 |
taaggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
54903419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 2180214 - 2180276
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
2180214 |
ttttaaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
2180276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 5827975 - 5827917
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
5827975 |
aaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgt |
5827917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 13064467 - 13064409
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13064467 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
13064409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 13074126 - 13074029
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||| | ||| || ||||||||| |||||||||||||||||| |
|
|
| T |
13074126 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgtaatttttttttgttgtttttgatccctgcaaaatattttg |
13074029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 13631602 - 13631544
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13631602 |
taaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 16712693 - 16712635
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16712693 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
16712635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 544
Target Start/End: Original strand, 23778962 - 23779016
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23778962 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc |
23779016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 26314334 - 26314276
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
26314334 |
aaggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgt |
26314276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 29499549 - 29499491
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29499549 |
taaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 32208538 - 32208592
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32208538 |
ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32208592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 32208905 - 32208851
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
32208905 |
ttaaggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagt |
32208851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 42823775 - 42823872
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
42823775 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgtaaattttttttgttgtttttagtccctgcaaaatattttg |
42823872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Complemental strand, 6827880 - 6827819
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6827880 |
ttttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 14791808 - 14791751
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
14791808 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 35415633 - 35415537
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||| ||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttg |
35415537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 41345851 - 41345908
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41345851 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 43231086 - 43231143
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
43231086 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 45505595 - 45505656
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
45505595 |
tttaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
45505656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 539
Target Start/End: Original strand, 4211560 - 4211608
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4211560 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
4211608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 13073759 - 13073815
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
13073815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 35763646 - 35763702
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35763646 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 487 - 539
Target Start/End: Original strand, 46292387 - 46292439
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46292387 |
tttatggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 489 - 588
Target Start/End: Original strand, 47022737 - 47022836
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||||| ||||||||||||||||| ||| | || |||||||||||||||||||||||||||| |
|
|
| T |
47022737 |
taaggataaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
47022836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 47023106 - 47023050
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
47023106 |
aggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 493 - 580
Target Start/End: Complemental strand, 51763201 - 51763114
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgtaaattttttttgttgtttttggtccctgcaaa |
51763114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 53308068 - 53307973
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | ||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatattttg |
53307973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 53717174 - 53717118
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
53717118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 53915682 - 53915738
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
53915682 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 6353637 - 6353582
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt |
6353582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 582
Target Start/End: Complemental strand, 19321859 - 19321769
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat |
582 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaat |
19321769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 20291985 - 20292036
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20291985 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
20292036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 487 - 542
Target Start/End: Original strand, 22099538 - 22099593
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22099538 |
tttatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22099593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 26412584 - 26412529
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 29420538 - 29420487
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
29420538 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
29420487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 497 - 587
Target Start/End: Complemental strand, 47532667 - 47532577
Alignment:
| Q |
497 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||||||||||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaattgttatttttggtccctgcaaaatatttt |
47532577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 51762868 - 51762966
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||| || ||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
51762868 |
aaggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
51762966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 2034857 - 2034799
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
2034857 |
aaggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgt |
2034799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 8904884 - 8904934
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8904884 |
aaggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 13064153 - 13064215
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
13064153 |
tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
13064215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 580
Target Start/End: Complemental strand, 14488188 - 14488099
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
14488188 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
14488099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 18205521 - 18205467
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
18205467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 22099916 - 22099862
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
22099916 |
ttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
22099862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 29463915 - 29463857
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
29463915 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgt |
29463857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 31812215 - 31812157
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
31812215 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
31812157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 32365485 - 32365427
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
32365485 |
aaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
32365427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 35119290 - 35119348
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
35119290 |
aaggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgt |
35119348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 36054152 - 36054094
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
36054152 |
aaggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
36054094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 36701994 - 36702056
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
36701994 |
ttttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
36702056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 38054544 - 38054602
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38054544 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
38054602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 45593592 - 45593530
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45593592 |
tttttaggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgt |
45593530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 51738136 - 51738233
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||| | ||||| || || ||||||||||||||||||||||||| |
|
|
| T |
51738136 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgtaaaaaaaaattgttctttttggtccctgcaaaatattttg |
51738233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 55072387 - 55072445
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
55072387 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
55072445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 6827543 - 6827596
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
6827543 |
taaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
6827596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 11693122 - 11693065
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
11693122 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgt |
11693065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 12152494 - 12152437
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
12152494 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgt |
12152437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 12791975 - 12791918
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12791975 |
aggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgt |
12791918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 13479612 - 13479555
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
13479612 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
13479555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 51545626 - 51545679
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
51545626 |
taaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
51545679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 51545966 - 51545913
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
51545913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 487 - 540
Target Start/End: Original strand, 52543417 - 52543470
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
52543417 |
tttaaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 123533 - 123589
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
123533 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 5052586 - 5052534
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5052586 |
aaggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
5052534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 5827655 - 5827711
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
5827711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 488 - 548
Target Start/End: Original strand, 8760600 - 8760660
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
8760600 |
ttaaggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgt |
8760660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 323 - 380
Target Start/End: Original strand, 9075166 - 9075225
Alignment:
| Q |
323 |
tataaagtaagaattttaaca--gtcttgaaccagttcagattatataatccaaacattt |
380 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9075166 |
tataaagtatgaattttaacacagtcttgaacgagttcagattatataatccaaacattt |
9075225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 9289265 - 9289321
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
9289265 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 13530378 - 13530434
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
13530378 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 13764613 - 13764669
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgt |
13764669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 494 - 542
Target Start/End: Original strand, 16712331 - 16712379
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagt |
16712379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 24474965 - 24474913
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
24474965 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
24474913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 26313988 - 26314044
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgt |
26314044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 27008084 - 27008140
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27008140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 484 - 540
Target Start/End: Complemental strand, 28449222 - 28449166
Alignment:
| Q |
484 |
agttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||| ||||||||| ||||| |
|
|
| T |
28449222 |
agttttaaggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 28809182 - 28809130
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
28809182 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
28809130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 29380912 - 29380860
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
29380912 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
29380860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 34361801 - 34361853
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
34361801 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
34361853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 41619902 - 41619954
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 46088061 - 46088005
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
46088061 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 46292653 - 46292601
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
46292653 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
46292601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 51709029 - 51708977
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
51709029 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
51708977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 54208827 - 54208775
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
54208827 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
54208775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 497 - 548
Target Start/End: Original strand, 2034544 - 2034595
Alignment:
| Q |
497 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
2034595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 9445946 - 9446005
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9445946 |
taagactaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
9446005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 11285504 - 11285559
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
11285559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 14791502 - 14791549
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
14791549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 540
Target Start/End: Complemental strand, 20144734 - 20144683
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
20144734 |
taaggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 29463610 - 29463665
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||| |||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggttttaattcctg |
29463665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 31182506 - 31182409
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||||| ||| ||||| || ||| |||||||||||||||||||||||| |
|
|
| T |
31182506 |
aaggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgtaaatttttgtttttg-ttttggtccctgcaaaatattttg |
31182409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 36050289 - 36050344
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgt |
36050344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 37557194 - 37557139
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||| ||||||| ||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgt |
37557139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 44925844 - 44925789
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||||||||||||||| ||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgt |
44925789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 50714240 - 50714295
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 50714565 - 50714510
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 51708692 - 51708743
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
51708692 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt |
51708743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 54903109 - 54903207
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| ||||||| |||||| ||||||| || ||||||||| |||| ||||||||||||| |
|
|
| T |
54903109 |
aaggttaaaatatggttttgatccctacaaatatgcatcgttttagttttaattcctgtaaaacaaatttgttgtttttgatccccgcaaaatattttg |
54903207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 8760783 - 8760725
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
8760783 |
aaggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgt |
8760725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 18136115 - 18136057
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||| |||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
18136115 |
aaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt |
18136057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 495 - 541
Target Start/End: Original strand, 20144423 - 20144469
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttag |
20144469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 27427869 - 27427926
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
27427869 |
taaggctaaaatatggtttag-tccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 35763956 - 35763859
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||| |||| |||||||| ||||||||||||||||||||||| |||| || |||||||||||||||||||||| ||||| |
|
|
| T |
35763956 |
aggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggtaatttttttttttgtttttggtccctgcaaaattttttg |
35763859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 41620259 - 41620201
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
41620259 |
taaggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 45474600 - 45474546
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
45474600 |
ttaaggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagt |
45474546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 49123323 - 49123265
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||| |||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
49123323 |
aaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt |
49123265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 52442094 - 52442036
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
52442094 |
aaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt |
52442036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 5882551 - 5882607
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
5882551 |
aggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgt |
5882607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 9075000 - 9075085
Alignment:
| Q |
129 |
tagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttata |
214 |
Q |
| |
|
|||||||||||||||||||||| | | |||| |||| ||||||||||||||||| ||||||||| || | ||| |||||||||| |
|
|
| T |
9075000 |
tagtttggtgttcagatcaatgatcaaagtgtacatggttatttggtgtggtttacaacatatgaaaaaacacacactaatttata |
9075085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 12152153 - 12152210
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
12152153 |
aggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgt |
12152210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 489 - 542
Target Start/End: Complemental strand, 13764810 - 13764757
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
13764810 |
taaggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagt |
13764757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 485 - 542
Target Start/End: Original strand, 14594199 - 14594256
Alignment:
| Q |
485 |
gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
14594199 |
gtttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagt |
14594256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 19903260 - 19903317
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||| ||||| ||||||| ||||| |
|
|
| T |
19903260 |
aggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgt |
19903317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 46115781 - 46115724
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
46115781 |
aaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 46128915 - 46128858
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
46128915 |
aaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 47136170 - 47136121
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
47136121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 52430101 - 52430044
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
52430101 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt |
52430044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 52441762 - 52441819
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
52441762 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
52441819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 540
Target Start/End: Complemental strand, 55072709 - 55072664
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
55072664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 5202929 - 5202977
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcg-ttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagt |
5202977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 8191391 - 8191335
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt |
8191335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 9289640 - 9289584
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
9289640 |
aggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 19321569 - 19321625
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||| ||||| |||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
19321569 |
aggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 35415298 - 35415354
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
35415298 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 588
Target Start/End: Complemental strand, 35420701 - 35420606
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||| |||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgtaattttttttttgttgtttttggtccctgcaaaatattttg |
35420606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 43368777 - 43368721
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| || || ||||||||| |||||||||||||||||||||| |
|
|
| T |
43368777 |
ggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctgt |
43368721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 539
Target Start/End: Complemental strand, 51738412 - 51738364
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||| |||| |
|
|
| T |
51738412 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttgatttt |
51738364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 511 - 590
Target Start/End: Original strand, 54208480 - 54208559
Alignment:
| Q |
511 |
tccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttgat |
590 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
54208480 |
tccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtctctgcaaaatattttgat |
54208559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 55482468 - 55482412
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgt |
55482412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 11692761 - 11692812
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| ||||||| ||||||| |
|
|
| T |
11692761 |
aggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagt |
11692812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 540
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 22584286 - 22584337
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
22584286 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
22584337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 497 - 548
Target Start/End: Complemental strand, 27008401 - 27008350
Alignment:
| Q |
497 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
27008350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 28448833 - 28448884
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
28448833 |
aggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagt |
28448884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 494 - 588
Target Start/End: Original strand, 30564835 - 30564929
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||||||||||| ||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgtagatttttgtttttgtttttgatccctgcaaaatattttg |
30564929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 538
Target Start/End: Complemental strand, 35119612 - 35119565
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
35119612 |
aggctaaaatatggttttggtcactgcaaatatgtctcgttttggttt |
35119565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 36702362 - 36702307
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| | |||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgt |
36702307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 41346219 - 41346168
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
41346219 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagt |
41346168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 487 - 542
Target Start/End: Complemental strand, 41921089 - 41921034
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
41921089 |
tttaaggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagt |
41921034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 53716920 - 53716971
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
53716920 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
53716971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 4279335 - 4279285
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagt |
4279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 35420393 - 35420447
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| | |||||||||||||| ||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgt |
35420447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 161 - 243
Target Start/End: Original strand, 41967707 - 41967789
Alignment:
| Q |
161 |
ccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttatagaagattatgtgtgtcgtggatcacaaaa |
243 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| || |||||||||||||| || | || |||||| | ||||||| |
|
|
| T |
41967707 |
ccatgattatttggtgtggtttacaacatatgaaaacaagcacactaatttatagaagtttctttgcgtcgtgtaccacaaaa |
41967789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 42824091 - 42824041
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||| ||||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagt |
42824041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 43368467 - 43368521
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
43368521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 497 - 542
Target Start/End: Complemental strand, 123893 - 123848
Alignment:
| Q |
497 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagt |
123848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 4279021 - 4279078
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
4279021 |
aggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgt |
4279078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 5797484 - 5797537
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||| ||||| || ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgt |
5797537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 540
Target Start/End: Complemental strand, 5797817 - 5797772
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5797772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 15555637 - 15555588
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt |
15555588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 22584608 - 22584551
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
22584608 |
aggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgt |
22584551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 539
Target Start/End: Original strand, 29380666 - 29380715
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
29380666 |
aaggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt |
29380715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 34355284 - 34355227
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
34355284 |
aggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgt |
34355227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 45593227 - 45593284
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||||||||||||| |||||| ||||| |
|
|
| T |
45593227 |
aggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgt |
45593284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 8905234 - 8905186
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| ||||| ||||| |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgatttta |
8905186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 28809011 - 28809067
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||||||||| ||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgt |
28809067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 213
Target Start/End: Complemental strand, 29551874 - 29551790
Alignment:
| Q |
129 |
tagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttat |
213 |
Q |
| |
|
|||||| |||||| |||||||| |||| |||||||||||| |||||||| ||||| | ||||| |||||||| ||||||||| |
|
|
| T |
29551874 |
tagtttagtgttcggatcaatgaccgaagtgtccatgattttttggtgtagtttactccttatgaaaacatacacactaatttat |
29551790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 543
Target Start/End: Original strand, 31370803 - 31370855
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt |
543 |
Q |
| |
|
|||||||||||||||||| | |||| ||||||||||||||||||||||||| |
|
|
| T |
31370803 |
aggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagtt |
31370855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 540
Target Start/End: Original strand, 7639897 - 7639944
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| || |||||||||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
7639944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 24474599 - 24474649
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagt |
24474649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 2180572 - 2180522
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagt |
2180522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 490 - 524
Target Start/End: Original strand, 9836830 - 9836864
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatg |
524 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
9836830 |
aaggctaaaatatggttttgatccttgcaaatatg |
9836864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 18831176 - 18831122
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||| ||||||| || |||||||||||||| ||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgt |
18831122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 489 - 523
Target Start/End: Complemental strand, 33137290 - 33137256
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatat |
523 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33137290 |
taaggctaaaatatgtttttgatccctgcaaatat |
33137256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 36050359 - 36050393
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggtttt |
36050393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||| ||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 494 - 540
Target Start/End: Complemental strand, 52543725 - 52543679
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggtttta |
52543679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 55805088 - 55805038
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||| |||||| | | ||||||||||||| |||||||||||||| |
|
|
| T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagt |
55805038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 486 - 523
Target Start/End: Original strand, 3879080 - 3879117
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatat |
523 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
3879080 |
tttttaggctaaaatatgcttttgatccctgcaaatat |
3879117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 493 - 538
Target Start/End: Original strand, 25358213 - 25358258
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||| |||||||||||| |
|
|
| T |
25358213 |
gctaaaatatgattttaatccatgcaaatatgcttcgttttggttt |
25358258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 30890832 - 30890881
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || |||| |||||||| |
|
|
| T |
30890832 |
gctaaaatatggttatgatccctgcaaatatgtcttattttagttttagt |
30890881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 524
Target Start/End: Original strand, 33134890 - 33134923
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatg |
524 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
33134890 |
aggctaaaatatgtttttgatccctgcaaatatg |
33134923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 37556840 - 37556897
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
37556840 |
aggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgt |
37556897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 429 - 470
Target Start/End: Complemental strand, 41508464 - 41508423
Alignment:
| Q |
429 |
ggttacttgttcagcaagagtaacttattgaacatgtttttc |
470 |
Q |
| |
|
||||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
41508464 |
ggttacttgctcagcaagagtaactcatggaacatgtttttc |
41508423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 50754257 - 50754200
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||| ||||||| || |||||| ||||||||| ||||| |
|
|
| T |
50754257 |
aggctaaaatatggttttgatcactgcaaacatatatcgtttaggttttagtccctgt |
50754200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 4e-25; HSPs: 175)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 10872913 - 10873011
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
10872913 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaaaaataatttgttgtttttagtccctgcaaaatattttg |
10873011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 4474049 - 4473988
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4474049 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt |
4473988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 488 - 588
Target Start/End: Original strand, 28346390 - 28346490
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
28346390 |
ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatatttt |
28346489 |
T |
 |
| Q |
588 |
g |
588 |
Q |
| |
|
| |
|
|
| T |
28346490 |
g |
28346490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 489 - 588
Target Start/End: Complemental strand, 7420593 - 7420494
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
7420593 |
taaggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
7420494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 8298977 - 8298879
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
8298977 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
8298879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 10337113 - 10337215
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
10337113 |
tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
10337212 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
10337213 |
ttg |
10337215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 37536084 - 37536182
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
37536084 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattttg |
37536182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 4710221 - 4710124
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
4710221 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
4710124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 6469279 - 6469376
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
6469279 |
aggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
6469376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 9496340 - 9496437
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
9496340 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattttg |
9496437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 34963664 - 34963568
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttattgtttttggtccctgcaaaatattttg |
34963568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 585
Target Start/End: Original strand, 11976371 - 11976465
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
11976371 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatatt |
11976465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 32725905 - 32726003
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
32725905 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
32726003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 3511905 - 3512002
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
3511905 |
aggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
3512002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 7326421 - 7326324
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaatttttttttattgtttttggtccctgtaaaatattttg |
7326324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 14495067 - 14495125
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14495067 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
14495125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 24187563 - 24187625
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24187563 |
ttttaaggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgt |
24187625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 34963297 - 34963355
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34963297 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 35097327 - 35097424
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
35097327 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
35097424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 35346999 - 35346902
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
35346999 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
35346902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 25600229 - 25600286
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25600229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgt |
25600286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 10776499 - 10776443
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
10776443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 11019858 - 11019802
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11019858 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 14239084 - 14239024
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14239084 |
ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14239024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 493 - 588
Target Start/End: Complemental strand, 24090487 - 24090392
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || ||||||||||||||| |||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaattgttgtttttggtccctacaaaatattttg |
24090392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 28346759 - 28346703
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28346759 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 32726272 - 32726216
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32726272 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 2728230 - 2728328
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
2728230 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
2728328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 2728597 - 2728542
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 484 - 547
Target Start/End: Complemental strand, 9496731 - 9496668
Alignment:
| Q |
484 |
agttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
9496731 |
agttctaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 10540785 - 10540726
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
10540785 |
taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt |
10540726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 11019516 - 11019575
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
11019516 |
ttaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 16789072 - 16789131
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16789072 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
16789131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 580
Target Start/End: Original strand, 20984144 - 20984234
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
20984144 |
aaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
20984234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 20984512 - 20984414
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
20984512 |
aaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttg |
20984414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 27341593 - 27341495
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| | || ||||||||||||||||||||||||| |
|
|
| T |
27341593 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttatttttggtccctgcaaaatattttg |
27341495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 35097692 - 35097637
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 582
Target Start/End: Complemental strand, 42133154 - 42133064
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat |
582 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaat |
42133064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 2811785 - 2811731
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2811785 |
ttaaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
2811731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 5357422 - 5357519
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||| | || ||||||||||| |||||||||||||||| |
|
|
| T |
5357422 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctataaaaaaattttgttgtttttggttcctgcaaaatattttg |
5357519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 580
Target Start/End: Original strand, 13154885 - 13154974
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
13154885 |
aggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgtaattttcttttgttgtttttggtccctgcaaa |
13154974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 495 - 588
Target Start/End: Complemental strand, 13796593 - 13796500
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttg |
13796500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 16789375 - 16789313
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16789375 |
ttttatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
16789313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 20277690 - 20277748
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
20277690 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt |
20277748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 20278058 - 20277961
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||| | ||| || ||||||||||||||| |||||||||||| |
|
|
| T |
20278058 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaatttttttttgttgtttttggtccctccaaaatattttg |
20277961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 21064317 - 21064375
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
21064317 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt |
21064375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 21064685 - 21064588
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||| | ||| || ||||||||||||||| |||||||||||| |
|
|
| T |
21064685 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaatttttttttgttgtttttggtccctccaaaatattttg |
21064588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 22917561 - 22917619
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22917561 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 25131109 - 25131167
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25131109 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
25131167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 40066495 - 40066553
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40066495 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgt |
40066553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 43477161 - 43477219
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43477161 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
43477219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 539
Target Start/End: Complemental strand, 3680803 - 3680754
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3680803 |
aaggctaaaatatgattttgatccctgcaaatatgcctcgttttggtttt |
3680754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 7420228 - 7420285
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7420228 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 580
Target Start/End: Original strand, 8298587 - 8298675
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
8298675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 582
Target Start/End: Original strand, 44997929 - 44998021
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat |
582 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||| ||||| ||||||| || |||||||||||||||||||||| |
|
|
| T |
44997929 |
aaggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgtaaattttttttgttgtttttggtccctgcaaaat |
44998021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 1525807 - 1525859
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1525807 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1525859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 3512267 - 3512211
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3512267 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 4621354 - 4621298
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
4621298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 7186004 - 7185948
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
7185948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 7326085 - 7326141
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
7326085 |
aggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 10337450 - 10337394
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
10337450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 544
Target Start/End: Complemental strand, 13232562 - 13232510
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttc |
13232510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 14489073 - 14489017
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
14489017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 487 - 547
Target Start/End: Complemental strand, 16644049 - 16643989
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
16644049 |
tttaaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 19494118 - 19494174
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19494118 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 19494414 - 19494358
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 32418316 - 32418368
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32418316 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32418368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 1778564 - 1778619
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 586
Target Start/End: Complemental strand, 7272751 - 7272657
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt |
586 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||| |||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgtaaacaaaattttttgtttttggtccctgcaaaaaattt |
7272657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 9175010 - 9175108
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||| ||||||||||||||||| ||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
9175010 |
aaggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtcccagcaaaatattttg |
9175108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 10873280 - 10873225
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 494 - 588
Target Start/End: Original strand, 13779151 - 13779245
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| | ||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgtaaaaaaaaaatgttgtttttggtctctgcaaaatattttg |
13779245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 25702506 - 25702608
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| |||||||||||||||| ||||||| ||||| || ||||||||||||| ||||||||||| |
|
|
| T |
25702506 |
tttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgtaagaaaaaattgttgtttttggtccatgcaaaatatt |
25702605 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
25702606 |
ttg |
25702608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 35346629 - 35346684
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 37536419 - 37536364
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 13155252 - 13155155
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||||||| | ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
13155252 |
aggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaattattgtttttgatccctgcaaaatattttg |
13155155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 14238749 - 14238807
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
14238749 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14238807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 580
Target Start/End: Complemental strand, 24815069 - 24814980
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||| ||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaa |
24814980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 484 - 542
Target Start/End: Complemental strand, 24955018 - 24954960
Alignment:
| Q |
484 |
agttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
24955018 |
agtttttaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagt |
24954960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 487 - 588
Target Start/End: Original strand, 28323844 - 28323944
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt |
586 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| |||||||||||||||| ||| | || |||||||||||||||||||||||||| |
|
|
| T |
28323844 |
tttaaggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct-ttaaaaaaaattgttgtttttggtccctgcaaaatattt |
28323942 |
T |
 |
| Q |
587 |
tg |
588 |
Q |
| |
|
|| |
|
|
| T |
28323943 |
tg |
28323944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 495 - 588
Target Start/End: Complemental strand, 28497616 - 28497523
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| | |||||||||||||||| ||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaatttttatgttgtttttggtccctgaaaaatattttg |
28497523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 29488112 - 29488054
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
29488112 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
29488054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 38930299 - 38930357
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
38930299 |
taaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg |
38930357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 4017302 - 4017245
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
4017302 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 13232201 - 13232254
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
13232254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 17073806 - 17073863
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
17073806 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
17073863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 17574464 - 17574407
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
17574464 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
17574407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 27117752 - 27117809
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
27117752 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgt |
27117809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 539
Target Start/End: Complemental strand, 27117978 - 27117929
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
27117978 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttt |
27117929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 29158353 - 29158410
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
29158353 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
29158410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 29992301 - 29992244
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
29992301 |
aggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgt |
29992244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 33526413 - 33526356
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33526413 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33526356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 587
Target Start/End: Original strand, 33652193 - 33652285
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| ||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagtttctgtaaattttttttgttgtttttggtccctgcaaaatatttt |
33652285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 1526173 - 1526117
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
1526173 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 1685112 - 1685164
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1685112 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1685164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Original strand, 4375692 - 4375740
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 4473703 - 4473759
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
4473703 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 6146510 - 6146566
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
6146510 |
ttttaaagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
6146566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 7272418 - 7272470
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
7272418 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
7272470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 493 - 541
Target Start/End: Complemental strand, 13779531 - 13779483
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttag |
13779483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 14847823 - 14847875
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14847823 |
aaggttaaaatatgattttgatccctgcaaatatgcctcattttggttttagt |
14847875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 16643660 - 16643716
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
16643660 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 28324185 - 28324125
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| || |||||||||||||| ||||| |
|
|
| T |
28324185 |
ttaaggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgt |
28324125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 28497253 - 28497305
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
28497253 |
aaggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagt |
28497305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 31445465 - 31445413
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
31445465 |
aaggctaaaatatagttttgatccctacaaatatgcctcattttggttttagt |
31445413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 35143845 - 35143789
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
35143845 |
aggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 40066820 - 40066764
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgt |
40066764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 40844156 - 40844212
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
40844212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Original strand, 42132864 - 42132912
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42132912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 585
Target Start/End: Original strand, 42429756 - 42429850
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| |||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
42429756 |
aaggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatatt |
42429850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 497 - 548
Target Start/End: Original strand, 3680532 - 3680583
Alignment:
| Q |
497 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgt |
3680583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 540
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 6146948 - 6146893
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
6146893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 8094842 - 8094791
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
8094842 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
8094791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 9175368 - 9175321
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagt |
9175321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 10540448 - 10540499
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
10540448 |
aggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagt |
10540499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 18549200 - 18549251
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
18549200 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
18549251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 33636321 - 33636372
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
33636321 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
33636372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 540
Target Start/End: Complemental strand, 38930667 - 38930616
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
38930667 |
taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
38930616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 1408357 - 1408303
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
1408357 |
ttaaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagt |
1408303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 2355883 - 2355937
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
2355883 |
ttaaggctaaaatataggtttgatccctgcaaatataccttgttttggttttagt |
2355937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 18549571 - 18549517
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgt |
18549517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 21125717 - 21125767
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21125717 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
21125767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 22650462 - 22650520
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
22650462 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
22650520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 546
Target Start/End: Original strand, 23939547 - 23939601
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct |
546 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |||||||| |||||||||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagttcct |
23939601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 25131447 - 25131397
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
25131397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 25600599 - 25600541
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
25600599 |
aaggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
25600541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 29158669 - 29158619
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagt |
29158619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 42430120 - 42430070
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
42430070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 44998263 - 44998213
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagt |
44998213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 5357762 - 5357713
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagt |
5357713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 14496813 - 14496866
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
14496813 |
taaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagt |
14496866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 24187899 - 24187842
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
24187899 |
aaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 497 - 542
Target Start/End: Original strand, 24814710 - 24814755
Alignment:
| Q |
497 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagt |
24814755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 540
Target Start/End: Complemental strand, 35345618 - 35345569
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
35345618 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
35345569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 40492959 - 40493016
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
40492959 |
aggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgt |
40493016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 8094478 - 8094534
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8094478 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 10755528 - 10755480
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10755480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 14488714 - 14488766
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
14488714 |
aaggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagt |
14488766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 493 - 588
Target Start/End: Original strand, 15930933 - 15931028
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||| ||||| | ||| |||||||| ||||||||||||||||| ||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccttgcaaaatattttg |
15931028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 23939912 - 23939860
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||| |||||||||| |||||| |
|
|
| T |
23939912 |
aaggttaaaatatggttttgattcctgcaaatatgactcgttttggctttagt |
23939860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 29991913 - 29991965
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
29991913 |
aaggttaaaatatggttttggtctctgcaaatatgcctcgttttagttttagt |
29991965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 538
Target Start/End: Complemental strand, 30337223 - 30337171
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
30337223 |
ttttaaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 1162909 - 1162964
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 14495394 - 14495340
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||| || |||| ||||||||||||||||||||||||||| |
|
|
| T |
14495394 |
ttaatgctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagt |
14495340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 28258242 - 28258191
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| | | ||||||||||| ||||||||||||||||| |
|
|
| T |
28258242 |
aggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagt |
28258191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 540
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 540
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 15719656 - 15719706
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagt |
15719706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 26530666 - 26530724
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||| |||||||||||| ||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
26530666 |
aaggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctgt |
26530724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 33526052 - 33526102
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagt |
33526102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 40844537 - 40844479
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
40844537 |
aaggttaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgt |
40844479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 43727097 - 43727151
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgt |
43727151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 28399036 - 28398979
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
28399036 |
aggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgt |
28398979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 492 - 537
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt |
537 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 1408005 - 1408061
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||| ||||||| |||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttagctcctgt |
1408061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 528
Target Start/End: Complemental strand, 30969717 - 30969681
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctc |
528 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 539
Target Start/End: Complemental strand, 35115640 - 35115592
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
35115640 |
aggctaaaatatggttttagtccctacaaatatacctcgttttggtttt |
35115592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 2356245 - 2356198
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||| ||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
2356245 |
taaaatatgattttgattcatgcaaatatgtctcgttttggttttagt |
2356198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 4376011 - 4375961
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
4376011 |
aggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagt |
4375961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 27341257 - 27341308
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| |||||| ||||||| |
|
|
| T |
27341257 |
aggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagt |
27341308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 30969399 - 30969454
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| |||||||||||||||| ||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgt |
30969454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 1163274 - 1163224
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||| |||||| |||||||| |
|
|
| T |
1163274 |
ggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagt |
1163224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 534
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
534 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||||||||| |
|
|
| T |
9908918 |
ggctaaaatatagttttaatccctgcaaatatgtctcgttttg |
9908960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 491 - 533
Target Start/End: Complemental strand, 25702810 - 25702768
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgtttt |
533 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
25702810 |
aggctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 29487750 - 29487800
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagt |
29487800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 32040069 - 32040131
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||| | || |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
32040069 |
tttttaggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgt |
32040131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 558 - 588
Target Start/End: Original strand, 32195345 - 32195375
Alignment:
| Q |
558 |
ttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32195345 |
ttattgtttttggtccctgcaaaatattttg |
32195375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 6469668 - 6469611
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
6469668 |
aggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgt |
6469611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 7578527 - 7578478
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||| |||||| || |||||||||||| ||| ||||||||||||| |
|
|
| T |
7578527 |
gctaaaatacggttttaattcctgcaaatatgactcattttggttttagt |
7578478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 19962994 - 19963051
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| || ||| |||||||||| |||||||| |||||||| ||||| |
|
|
| T |
19962994 |
aggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgt |
19963051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 21126022 - 21125965
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||| ||| || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
21126022 |
aggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgt |
21125965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 490 - 523
Target Start/End: Complemental strand, 22534783 - 22534750
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatat |
523 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
22534783 |
aaggctaaaatatgcttttgatccctgcaaatat |
22534750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 518 - 547
Target Start/End: Original strand, 24954697 - 24954726
Alignment:
| Q |
518 |
aaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24954697 |
aaatatgcctcgttttggttttagttcctg |
24954726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 4e-25; HSPs: 180)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 1614906 - 1614808
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1614906 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
1614808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 9659691 - 9659593
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
9659691 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
9659593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 489 - 588
Target Start/End: Complemental strand, 45228921 - 45228822
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
45228921 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgtaaaatattttg |
45228822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 5354762 - 5354864
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
5354762 |
tttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
5354861 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
5354862 |
ttg |
5354864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 44568692 - 44568594
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
44568692 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
44568594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 29198663 - 29198566
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
29198663 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
29198566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 490 - 582
Target Start/End: Original strand, 3975547 - 3975639
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat |
582 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
3975547 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaat |
3975639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 584
Target Start/End: Complemental strand, 16853589 - 16853497
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat |
584 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaataaaatttgttgtttttggtccctgcaaaatat |
16853497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 488 - 588
Target Start/End: Original strand, 46828940 - 46829040
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| || |||||||||||||| ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
46828940 |
ttaaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatatttt |
46829039 |
T |
 |
| Q |
588 |
g |
588 |
Q |
| |
|
| |
|
|
| T |
46829040 |
g |
46829040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 489 - 588
Target Start/End: Original strand, 41053839 - 41053938
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||| ||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
41053839 |
taaggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
41053938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 5234206 - 5234108
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
5234206 |
aaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
5234108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 8144293 - 8144391
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
8144293 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg |
8144391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 8 - 235
Target Start/End: Original strand, 18044338 - 18044565
Alignment:
| Q |
8 |
cttatatctctgtggttgagttgactgttgattagatctacatgattcttcaaacttgagagtgtcacatcatttcagacccttaacatatattgtttcc |
107 |
Q |
| |
|
||||| ||| |||||||||||| | | ||||| |||| | |||| |||||| || ||||||| |||||||||| |||||| ||||||| |||||| |
|
|
| T |
18044338 |
cttatgtctatgtggttgagttaatgggtgatttgatccaattgatccttcaacctatagagtgtgacatcatttcggaccctgaacatatgaggtttcc |
18044437 |
T |
 |
| Q |
108 |
cccgttgtggtatatttcacttagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagcta |
207 |
Q |
| |
|
|||| ||| ||| | | | ||||||| |||||| ||||||| | || |||||||||||||||||||||| |||| ||||||||| || | || |||| |
|
|
| T |
18044438 |
cccgctgtagtagactatatctagtttgatgttcatatcaatgactgaagtgtccatgattatttggtgtgatttacaacatatgaaaataggcacgcta |
18044537 |
T |
 |
| Q |
208 |
atttatagaagattatgtgtgtcgtgga |
235 |
Q |
| |
|
|||| ||| || || ||||||||||||| |
|
|
| T |
18044538 |
atttgtagtagtttttgtgtgtcgtgga |
18044565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 25092550 - 25092452
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
25092550 |
aaggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
25092452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 27037587 - 27037689
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||| |||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
27037587 |
ttttatggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatt |
27037686 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
27037687 |
ttg |
27037689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 489 - 587
Target Start/End: Complemental strand, 30223798 - 30223700
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||| | ||| || ||||||||||||||||||||||||||| |
|
|
| T |
30223798 |
taaggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatatttt |
30223700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 35838343 - 35838241
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||| |||||||||||||||| |
|
|
| T |
35838343 |
tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgttttttgtccctgcaaaatatt |
35838244 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
35838243 |
ttg |
35838241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 48854072 - 48853974
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
48854072 |
aaggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
48853974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 587
Target Start/End: Complemental strand, 23399978 - 23399881
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
23399978 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatatttt |
23399881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 25988384 - 25988481
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
25988384 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
25988481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 48192489 - 48192392
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||| ||||||||||||||||||||| |
|
|
| T |
48192489 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttctggtccctgcaaaatattttg |
48192392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 22539929 - 22539986
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
22539929 |
aggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt |
22539986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 23399606 - 23399667
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23399606 |
tttttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 25988751 - 25988694
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25988751 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 587
Target Start/End: Original strand, 28262712 - 28262808
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| | ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
28262712 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaaaaaaaagttgttgtttttggtccctgcaaaatatttt |
28262808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 35469880 - 35469976
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgtaaaatttttttgttgtttttggtccctgcaaaatattttg |
35469976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 8144659 - 8144603
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8144659 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 23676453 - 23676397
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23676453 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 26878072 - 26878016
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26878072 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 3975839 - 3975788
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3975839 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
3975788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 13770084 - 13770025
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13770084 |
taaggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgt |
13770025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 580
Target Start/End: Original strand, 27458397 - 27458487
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
27458397 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaacttgttgtttttggtccctgcaaa |
27458487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 34878127 - 34878029
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||| || |||||||||||||||| ||||||||||| |
|
|
| T |
34878127 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaatctctgtaaattttttttgttgtttttggtccctggaaaatattttg |
34878029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 486 - 580
Target Start/End: Complemental strand, 41054242 - 41054148
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
41054242 |
tttttaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa |
41054148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 12894404 - 12894346
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12894404 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
12894346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 19757746 - 19757804
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19757746 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
19757804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 26877675 - 26877733
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26877675 |
taaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 28911908 - 28911850
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28911908 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28911850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 580
Target Start/End: Complemental strand, 35470281 - 35470192
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
35470281 |
aggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattattgttttttgtccctgcaaa |
35470192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 37372906 - 37372848
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37372906 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgt |
37372848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 5233806 - 5233863
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
5233806 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 6108332 - 6108389
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6108332 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 17999722 - 17999665
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17999722 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
17999665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 25092158 - 25092215
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25092158 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 495 - 544
Target Start/End: Original strand, 25547256 - 25547305
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagttc |
25547305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 35104296 - 35104239
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35104296 |
aggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
35104239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 35665876 - 35665933
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
35665876 |
aggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgt |
35665933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 35837921 - 35837974
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
35837921 |
taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35837974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 44509056 - 44508999
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44509056 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 44841359 - 44841412
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgt |
44841412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 48192255 - 48192312
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48192255 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 1614558 - 1614614
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
1614558 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 544
Target Start/End: Original strand, 19561154 - 19561206
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc |
19561206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 489 - 588
Target Start/End: Complemental strand, 39520733 - 39520634
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||||| ||||||||| ||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
39520733 |
taaggttaaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
39520634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 486 - 589
Target Start/End: Original strand, 44402954 - 44403057
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| | ||||||||||||| ||||| | |||||||||||||||||||||| || |
|
|
| T |
44402954 |
ttttaaggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgtaaaaataaaattttgtttttggtccctgcaaaatttt |
44403053 |
T |
 |
| Q |
586 |
ttga |
589 |
Q |
| |
|
|||| |
|
|
| T |
44403054 |
ttga |
44403057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 46759652 - 46759708
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
46759652 |
tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
46759708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 46829312 - 46829256
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgt |
46829256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 48852442 - 48852494
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
48852442 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagt |
48852494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 1006835 - 1006890
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 539
Target Start/End: Original strand, 6589021 - 6589068
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
6589068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 8555801 - 8555703
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
8555801 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaacaaaaattgtttttggtccctgcaaaattttttg |
8555703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 11767281 - 11767179
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| || ||||||||||||| ||||| || || ||||||||||||| |||||||| |
|
|
| T |
11767281 |
tttttaggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgtaaaaaaaatttgttatttttggtccctgaaaaatatt |
11767182 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
11767181 |
ttg |
11767179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 586
Target Start/End: Complemental strand, 12932784 - 12932690
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt |
586 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| ||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
12932784 |
aggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgt-aaaaaaatttgttgtttttggtccctgcaaaatattt |
12932690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 38486791 - 38486740
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
38486791 |
aggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagt |
38486740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 39438740 - 39438791
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
39438740 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagt |
39438791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 44508720 - 44508775
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 2945847 - 2945789
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
2945847 |
aaggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgt |
2945789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 3807863 - 3807960
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||| ||||||||||||||||||||||| || ||||||||| ||| |||||||||||||| |
|
|
| T |
3807863 |
aggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgtaaaaagaatttgttgtttttgatccttgcaaaatattttg |
3807960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 6509206 - 6509264
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
6509206 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgt |
6509264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 6509472 - 6509414
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
6509472 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
6509414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 7431951 - 7432001
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
7432001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 16940760 - 16940818
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
16940760 |
aaggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgt |
16940818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 28911576 - 28911673
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
28911576 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttg |
28911673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 35015221 - 35015124
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||| |||| || |||||||||||||||||||||| ||||| |
|
|
| T |
35015221 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttg |
35015124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 35210176 - 35210238
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||| |||||||||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35210176 |
tttttaggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgt |
35210238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 44344791 - 44344733
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
44344791 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
44344733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 44568323 - 44568381
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
44568323 |
taaggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 45021857 - 45021760
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||| || | ||||||||||||||||||||||| ||||| |
|
|
| T |
45021857 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagttcatggtaaaaaaaataattgtttttggtccctgcaaaattttttg |
45021760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 45073643 - 45073585
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45073643 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45073585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 493 - 592
Target Start/End: Original strand, 6079810 - 6079906
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttgatcc |
592 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaa---attgtttttggtccctgcaaaattttttgatcc |
6079906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 16941049 - 16940996
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
16940996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 20388273 - 20388330
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
20388273 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
20388330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 30223459 - 30223516
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
30223459 |
aaggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 39439031 - 39438974
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
39439031 |
aaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 39832905 - 39832962
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
39832905 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
39832962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 6589276 - 6589224
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
6589276 |
aaggttaaaatatggttttggtccctgcaaatatgccttgttttggttttagt |
6589224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 6847117 - 6847069
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt |
6847069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 9659354 - 9659410
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
9659354 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 10358368 - 10358312
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
10358312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 539
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
11766964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 14543708 - 14543760
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
14543708 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
14543760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 17999465 - 17999521
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgt |
17999521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 19561450 - 19561394
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
19561394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 21223750 - 21223698
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
21223750 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
21223698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 29198302 - 29198358
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
29198302 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 35210515 - 35210459
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
35210459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 39833236 - 39833180
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt |
39833180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 46759942 - 46759886
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgt |
46759886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 544
Target Start/End: Complemental strand, 48359075 - 48359023
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttc |
48359023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 501 - 548
Target Start/End: Complemental strand, 1271590 - 1271543
Alignment:
| Q |
501 |
atggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
1271543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 5355114 - 5355067
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagt |
5355067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 18022705 - 18022654
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18022705 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
18022654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 23816669 - 23816720
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
23816669 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt |
23816720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 31503418 - 31503516
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||||||| ||| ||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
31503418 |
aaggttaaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatattttg |
31503516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 541
Target Start/End: Original strand, 38186364 - 38186415
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
38186364 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttgattttag |
38186415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 45073308 - 45073410
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| ||||||||||||||||| | ||||| | |||||||||||||||||||||| || |
|
|
| T |
45073308 |
tttttaggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgtaaaaataaaattttgtttttggtccctgcaaaatttt |
45073407 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
45073408 |
ttg |
45073410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 1559707 - 1559649
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
1559707 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgt |
1559649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 13769774 - 13769824
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
13769824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 538
Target Start/End: Complemental strand, 31310683 - 31310633
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
31310683 |
ttaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 32189388 - 32189334
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
32189334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 38486477 - 38486574
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||||| |||||||| |||||||||||| | || | |||||||||||||||||||||||||| |
|
|
| T |
38486477 |
aggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagttcctctaaaacaaatttgtcgtttttggtccctgcaaaatattttg |
38486574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 39520396 - 39520454
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| ||||||||||||||||| ||||| |
|
|
| T |
39520396 |
aaggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgt |
39520454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 44958508 - 44958450
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
44958508 |
aaggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgt |
44958450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 45021488 - 45021550
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgtttt-ggttttagttcctg |
547 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
45021488 |
ttttatggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 540
Target Start/End: Complemental strand, 46648717 - 46648667
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
46648717 |
aaggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 488 - 588
Target Start/End: Original strand, 1559339 - 1559439
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||| ||||| | ||||| | |||||||||||||||||||||| |||| |
|
|
| T |
1559339 |
ttaaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgttaaaaaaacattttgtttttggtccctgcaaaatttttt |
1559438 |
T |
 |
| Q |
588 |
g |
588 |
Q |
| |
|
| |
|
|
| T |
1559439 |
g |
1559439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 10358000 - 10358057
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| | || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10358000 |
aggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgt |
10358057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 14739006 - 14738949
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
14739006 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 493 - 546
Target Start/End: Original strand, 18022368 - 18022421
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct |
546 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcct |
18022421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 20388680 - 20388619
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||||||| || ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
20388680 |
tttatggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgt |
20388619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 21554754 - 21554697
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||| ||||||| ||||| |
|
|
| T |
21554754 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgt |
21554697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 30352558 - 30352615
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
30352558 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 35104076 - 35104133
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35104076 |
aaggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 38186767 - 38186710
Alignment:
| Q |
486 |
ttttaaggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
38186767 |
ttttaaggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagt |
38186710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 39719643 - 39719586
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
39719643 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgt |
39719586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 1974009 - 1974065
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
1974065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 21223399 - 21223455
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
21223399 |
ttttagggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt |
21223455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 25547490 - 25547434
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
25547434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 540
Target Start/End: Original strand, 31732101 - 31732149
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
31732149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 37372441 - 37372493
Alignment:
| Q |
496 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
37372493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 41364884 - 41364940
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt |
41364940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 45228614 - 45228670
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||| |||||||| |||| |
|
|
| T |
45228614 |
aggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 46304084 - 46304136
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||||||||||||||||||| |
|
|
| T |
46304084 |
aaggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagt |
46304136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 7432249 - 7432202
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| ||||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagt |
7432202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 19783814 - 19783865
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
19783814 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt |
19783865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 20355407 - 20355458
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| |||||||||||| |||| |
|
|
| T |
20355407 |
aggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagt |
20355458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 30352904 - 30352849
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30352849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 30709645 - 30709594
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
30709645 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
30709594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 490 - 541
Target Start/End: Complemental strand, 31732453 - 31732402
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
31732453 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 34877777 - 34877824
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagt |
34877824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 37527421 - 37527366
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| || |||||||||||||| ||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgt |
37527366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 41365213 - 41365158
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| | || |||||||||||||||||||||||||||| |||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagtttctgt |
41365158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 1007229 - 1007179
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| ||||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagt |
1007179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 5308688 - 5308631
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||| | ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
5308688 |
aaggctaaaatatgttttag-tccctgcaaatatacctcgttttggttttagtccctgt |
5308631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 496 - 542
Target Start/End: Original strand, 6954862 - 6954908
Alignment:
| Q |
496 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagt |
6954908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 17854151 - 17854205
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt |
17854205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 21554393 - 21554443
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagt |
21554443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 23817036 - 23816978
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
23817036 |
aaggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgt |
23816978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 24717532 - 24717482
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||| ||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagt |
24717482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 28263069 - 28263015
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| ||||||| ||||| |
|
|
| T |
28263069 |
ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgt |
28263015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 30709321 - 30709375
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||| ||||||||| |||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
30709321 |
ttaaggttaaaatatgattttagtccctacaaatatgcctcgttttggttttagt |
30709375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 36684533 - 36684583
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
36684533 |
aaggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 39719353 - 39719403
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| ||||||||||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagt |
39719403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 44403249 - 44403199
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
44403199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 6892261 - 6892204
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| || ||||||| |||||| ||||| |
|
|
| T |
6892261 |
aggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgt |
6892204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 19465981 - 19465925
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
19465981 |
aggctaaaatatggtttt-agccctgcaaatatgtctcgtttcggttttagtccctgt |
19465925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 43300613 - 43300662
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagt |
43300662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 45671217 - 45671270
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgt |
45671270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 5308323 - 5308379
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||| |||||||| ||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgt |
5308379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 28528905 - 28528961
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| | |||| ||||||| ||||||| ||||||||| ||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgt |
28528961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 495 - 539
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 540
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 37953057 - 37953001
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||| |||||||||||||| |||||| ||||||| || |||||||||||||| |
|
|
| T |
37953057 |
ttttaaggataaaatatggttttagtccctgtaaatatgtcttgttttggttttagt |
37953001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 505 - 580
Target Start/End: Complemental strand, 41054163 - 41054088
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa |
41054088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 46304384 - 46304328
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
46304328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 540
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 492 - 543
Target Start/End: Original strand, 19005598 - 19005649
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt |
543 |
Q |
| |
|
||||||||||| |||||| |||||| ||||||| ||||||||| |||||||| |
|
|
| T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagtt |
19005649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 31310364 - 31310415
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
31310364 |
aggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagt |
31310415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 31503780 - 31503733
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
31503733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 489074 - 489016
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
489074 |
aaggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgt |
489016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 558 - 588
Target Start/End: Original strand, 6911149 - 6911179
Alignment:
| Q |
558 |
ttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6911149 |
ttattgtttttggtccctgcaaaatattttg |
6911179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 518 - 548
Target Start/End: Complemental strand, 22540265 - 22540235
Alignment:
| Q |
518 |
aaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22540265 |
aaatatgcctcgttttggttttagttcctgt |
22540235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 486 - 544
Target Start/End: Complemental strand, 24954156 - 24954098
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
|||||||| ||||||||||| || ||||||||||||| |||||||||||||||||| |
|
|
| T |
24954156 |
ttttaaggttaaaatatggtcttagaccctgcaaatatgattcgttttggttttagttc |
24954098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 490 - 524
Target Start/End: Original strand, 41693643 - 41693677
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatg |
524 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
41693643 |
aaggctaaaatatgtttttgatccctgcaaatatg |
41693677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 495 - 533
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgtttt |
533 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgtttt |
44841673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 505 - 542
Target Start/End: Complemental strand, 3808106 - 3808069
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagt |
3808069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 540
Target Start/End: Original strand, 12894060 - 12894089
Alignment:
| Q |
511 |
tccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12894060 |
tccctgcaaatatgcctcgttttggtttta |
12894089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 548
Target Start/End: Complemental strand, 19758040 - 19758003
Alignment:
| Q |
511 |
tccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19758040 |
tccctgcaaatatgcctcattttggttttagtccctgt |
19758003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 4e-25; HSPs: 142)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 12299142 - 12299044
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
12299142 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttctggtccctgcaaaatattttg |
12299044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 491 - 585
Target Start/End: Complemental strand, 3969010 - 3968916
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
3969010 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
3968916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 3414386 - 3414483
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
3414386 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg |
3414483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 20467719 - 20467622
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
20467719 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgcaaaaaaaatttgttgtttttgatccctgcaaaatattttg |
20467622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 21993786 - 21993883
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
21993786 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
21993883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 22543353 - 22543450
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
22543353 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
22543450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 21385586 - 21385488
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
21385586 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
21385488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 6412217 - 6412314
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
6412217 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg |
6412314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 25137358 - 25137261
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||||||||| ||||| |
|
|
| T |
25137358 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaatttttttttgttgtttttagtccctgcaaaatgttttg |
25137261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 1007510 - 1007453
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1007510 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
1007453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 19321132 - 19321075
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19321132 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttactgt |
19321075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 12419939 - 12419883
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12419939 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 17765007 - 17765106
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
17765007 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtttctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
17765106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 21994404 - 21994348
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21994404 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 32885672 - 32885728
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32885672 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 486 - 580
Target Start/End: Original strand, 1007118 - 1007212
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
1007118 |
tttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa |
1007212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 488 - 547
Target Start/End: Complemental strand, 6412583 - 6412524
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
6412583 |
ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 12419707 - 12419758
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12419707 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
12419758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 587
Target Start/End: Original strand, 12757607 - 12757705
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || ||||||||||||||| ||||||||||| |
|
|
| T |
12757607 |
taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgtaattttttttttttgtttttggtccctacaaaatatttt |
12757705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 23502546 - 23502444
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||| | ||||| || |||||||| |||||||||||||||| |
|
|
| T |
23502546 |
ttttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgtaattttttgttgttgttttttgtccctgcaaaatatt |
23502447 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
23502446 |
ttg |
23502444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 488 - 547
Target Start/End: Complemental strand, 24274135 - 24274076
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24274135 |
ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 580
Target Start/End: Complemental strand, 10910965 - 10910876
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
10910965 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaataaatttgttgtttttggtccctgcaaa |
10910876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 13268105 - 13268159
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
13268105 |
ttaaggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagt |
13268159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 19690391 - 19690449
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
19690391 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
19690449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 25136992 - 25137050
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25136992 |
aaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgt |
25137050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 487 - 588
Target Start/End: Original strand, 34582524 - 34582625
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt |
586 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||| ||| |
|
|
| T |
34582524 |
tttatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaaattttt |
34582623 |
T |
 |
| Q |
587 |
tg |
588 |
Q |
| |
|
|| |
|
|
| T |
34582624 |
tg |
34582625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 489 - 542
Target Start/End: Complemental strand, 3276357 - 3276304
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
3276357 |
taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
3276304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 3968643 - 3968700
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3968643 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 15076206 - 15076149
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15076206 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 21147403 - 21147460
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
21147403 |
aggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgt |
21147460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 21385249 - 21385306
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
21385249 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 539
Target Start/End: Original strand, 23502235 - 23502284
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23502235 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 24273826 - 24273883
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24273826 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 33801745 - 33801688
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33801745 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 543
Target Start/End: Complemental strand, 778043 - 777991
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt |
543 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
778043 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtt |
777991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 7156161 - 7156105
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7156161 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 15962389 - 15962333
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
15962333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 22543719 - 22543663
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
22543719 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 493 - 588
Target Start/End: Complemental strand, 30479421 - 30479326
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||| | | |||||||||||||||||||||||||||| ||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttggtccttgcaaaatattttg |
30479326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 1214997 - 1214946
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
1214997 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagt |
1214946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 8170152 - 8170101
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
8170152 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
8170101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 494 - 580
Target Start/End: Original strand, 13617531 - 13617617
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa |
13617617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 14656263 - 14656204
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
14656263 |
taaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt |
14656204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 494405 - 494455
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
494455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 18024376 - 18024279
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| ||||| || |||||||| |||| |||||||||||||| |
|
|
| T |
18024376 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaaaaaaatttgttgttttttgtccttgcaaaatattttg |
18024279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 487 - 588
Target Start/End: Original strand, 19267560 - 19267661
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt |
586 |
Q |
| |
|
|||| |||||||||||||||||| |||||| |||||||| |||||||||||||||| ||||| || |||||||||||| |||||||||||| |
|
|
| T |
19267560 |
tttatggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgtgaaaaaaatttgctgtttttggtccttgcaaaatattt |
19267659 |
T |
 |
| Q |
587 |
tg |
588 |
Q |
| |
|
|| |
|
|
| T |
19267660 |
tg |
19267661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 21995062 - 21995120
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
21995062 |
aaggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgt |
21995120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 24901239 - 24901289
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
24901289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 26375691 - 26375741
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
26375691 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
26375741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 30928679 - 30928737
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30928679 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
30928737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 493 - 547
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 34990321 - 34990259
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
34990321 |
ttttaaggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
34990259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 318098 - 318041
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
318098 |
aggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgt |
318041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 3414754 - 3414697
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
3414754 |
aaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 7155795 - 7155852
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7155795 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 8681118 - 8681061
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
8681118 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 20467349 - 20467406
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| |||||||| |||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20467349 |
aaggataaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 22822653 - 22822596
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
22822653 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 25431855 - 25431798
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
25431855 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
25431798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 26376042 - 26375989
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
26375989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 34582893 - 34582836
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
34582893 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgt |
34582836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 1890453 - 1890397
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
1890453 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 3356140 - 3356192
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
3356140 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
3356192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 8680774 - 8680830
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8680774 |
aggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 14655378 - 14655434
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
14655378 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 15962026 - 15962082
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
15962026 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 19129335 - 19129391
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19129335 |
aggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 19296407 - 19296359
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19296359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 22792901 - 22792849
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
22792901 |
aaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagt |
22792849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 30929044 - 30928988
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30928988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 496 - 547
Target Start/End: Original strand, 543365 - 543416
Alignment:
| Q |
496 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 2615871 - 2615922
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
2615871 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
2615922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 3356495 - 3356448
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3356448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 585
Target Start/End: Complemental strand, 7324189 - 7324099
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
7324099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 13150752 - 13150654
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||| || | ||||||||||||| ||||||||||||||||| ||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
13150752 |
aaggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgtaaacagaaatatttgtttttggtccctgcaaaattttttg |
13150654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 14428651 - 14428706
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
14428706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 23770162 - 23770217
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
23770217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 2373177 - 2373235
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||| |||| ||||| |
|
|
| T |
2373177 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgt |
2373235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 6468308 - 6468366
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | |||||||||||||| ||||| |
|
|
| T |
6468308 |
aaggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt |
6468366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 11448533 - 11448587
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
11448533 |
ttaaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
11448587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 11449171 - 11449113
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||| |||| ||||| |
|
|
| T |
11449171 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgt |
11449113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 495 - 588
Target Start/End: Complemental strand, 12176640 - 12176547
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||| ||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaattttttg |
12176547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 12612365 - 12612303
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||||| || ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
12612365 |
tttttaggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgt |
12612303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||| ||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 17771911 - 17771961
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
17771961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 580
Target Start/End: Complemental strand, 19129521 - 19129432
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| | ||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
19129521 |
aggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaa |
19129432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 33131852 - 33131794
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
33131852 |
aaggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgt |
33131794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 539
Target Start/End: Complemental strand, 2616242 - 2616193
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
2616242 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 539
Target Start/End: Original strand, 6591113 - 6591162
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
6591113 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 587
Target Start/End: Complemental strand, 15722901 - 15722805
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| || ||||||||||| |||| || |||||||||||| |||||||||||||| |
|
|
| T |
15722901 |
aggctaaaatatagttttgattcctgcaaatatgccttgtgttggttttagtctctgtaaattttttttgttgtttttggtctctgcaaaatatttt |
15722805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 18024014 - 18024067
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgt |
18024067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 25121497 - 25121440
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
25121497 |
aggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgt |
25121440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 9896639 - 9896587
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
9896639 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
9896587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 10910629 - 10910685
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgt |
10910685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 544
Target Start/End: Complemental strand, 11129543 - 11129491
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
11129543 |
ggctaaaatatgattttactccctgcaaatatgcctcgttttggttttcgttc |
11129491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 504 - 548
Target Start/End: Complemental strand, 13617804 - 13617760
Alignment:
| Q |
504 |
gttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
13617760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 21995425 - 21995369
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgt |
21995369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 22822305 - 22822357
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
22822305 |
aaggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 24692980 - 24692924
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
24692980 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 31186591 - 31186535
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgt |
31186535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 33808619 - 33808675
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 486 - 541
Target Start/End: Original strand, 317806 - 317861
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
317806 |
tttttaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttag |
317861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 540
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 6564944 - 6564894
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
6564944 |
aggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagt |
6564894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 12298825 - 12298872
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagt |
12298872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 490 - 580
Target Start/End: Complemental strand, 17765377 - 17765287
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| |||||||| ||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
17765377 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgtaaatttttgttgttgtttttggtccctgcaaa |
17765287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 25121183 - 25121233
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
25121183 |
aggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagt |
25121233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 25431573 - 25431632
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
25431573 |
taaggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgt |
25431632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 31167200 - 31167145
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 9896280 - 9896334
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||||| ||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgt |
9896334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 14655897 - 14655959
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||| |||||||| ||||||||| ||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
14655897 |
ttttagggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgt |
14655959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 19296106 - 19296164
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
19296106 |
aaggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgt |
19296164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 540
Target Start/End: Original strand, 19320769 - 19320815
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
19320815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 491 - 533
Target Start/End: Complemental strand, 23770440 - 23770398
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgtttt |
533 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23770440 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 777675 - 777732
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||| |||| | ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
777675 |
aaggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg |
777732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 1214693 - 1214746
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||| | | ||||||||||||| |
|
|
| T |
1214693 |
taaggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagt |
1214746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 1875501 - 1875558
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||||||||||||||| ||| || ||||| |
|
|
| T |
1875501 |
aggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctgt |
1875558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 1890057 - 1890114
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
1890057 |
aaggttaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 494 - 543
Target Start/End: Complemental strand, 6591440 - 6591391
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt |
543 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtt |
6591391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 10091039 - 10091092
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
10091092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 544
Target Start/End: Complemental strand, 11926034 - 11925981
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||| | ||||||||||||||||| |
|
|
| T |
11926034 |
aggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagttc |
11925981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 489 - 542
Target Start/End: Complemental strand, 14428953 - 14428900
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
14428953 |
taagactaaaatatggttttagtccttgcaaatatgcttcgttttggttttagt |
14428900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 15722609 - 15722666
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
15722609 |
aggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgt |
15722666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 23628799 - 23628848
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
23628848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 34989962 - 34990011
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagt |
34990011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 6564580 - 6564632
Alignment:
| Q |
491 |
aggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
6564580 |
aggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagt |
6564632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 486 - 545
Target Start/End: Original strand, 15116667 - 15116724
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc |
545 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||| |||||||||||||||||||| |
|
|
| T |
15116667 |
tttttaggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagttcc |
15116724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 30239287 - 30239343
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||| |||||||||||| |||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
30239287 |
ttttatggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagt |
30239343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 31398543 - 31398491
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
31398543 |
aaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
31398491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 489 - 528
Target Start/End: Complemental strand, 15117043 - 15117004
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctc |
528 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15117043 |
taaggctaaaatatggttttagtccctgcaaatatgcctc |
15117004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 31276339 - 31276284
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgt |
31276284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 11925739 - 11925789
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||| ||||| ||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagt |
11925789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 19267914 - 19267856
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||||| | | ||||||||||||| ||||| |
|
|
| T |
19267914 |
aaggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgt |
19267856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 496 - 534
Target Start/End: Complemental strand, 19690755 - 19690717
Alignment:
| Q |
496 |
aaaatatggttttgatccctgcaaatatgcctcgttttg |
534 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgttttg |
19690717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 491 - 537
Target Start/End: Original strand, 30479062 - 30479108
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt |
537 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| | |||||||||| |
|
|
| T |
30479062 |
aggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 540
Target Start/End: Complemental strand, 543725 - 543676
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| | |||||||||||| |
|
|
| T |
543725 |
aggctaaaatatgattttagtccctgcaaatatgctttgttttggtttta |
543676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 7323862 - 7323924
Alignment:
| Q |
490 |
aaggctaaaatatggttttgat----ccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| || || |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
7323862 |
aaggctaaaatatggttttaattagcccttgcaaatatgtctcgttttggttttagtccctgt |
7323924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 492 - 545
Target Start/End: Original strand, 12611995 - 12612048
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc |
545 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| ||||| ||||||||||| |
|
|
| T |
12611995 |
ggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagttcc |
12612048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 505 - 542
Target Start/End: Complemental strand, 19275223 - 19275186
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagt |
19275186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 24901555 - 24901498
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||| || ||||||||||||| ||||| |
|
|
| T |
24901555 |
aggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgt |
24901498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 4e-25; HSPs: 227)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 43441605 - 43441507
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
43441605 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
43441507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 490 - 585
Target Start/End: Original strand, 31480134 - 31480229
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
31480134 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
31480229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 19844583 - 19844485
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
19844583 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
19844485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 51550452 - 51550350
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
51550452 |
tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttggtccctgcaaaatatt |
51550353 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
51550352 |
ttg |
51550350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 28552020 - 28552117
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
28552020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattttg |
28552117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 47336582 - 47336485
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
47336582 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
47336485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 492 - 585
Target Start/End: Original strand, 49323782 - 49323875
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
49323875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 54608864 - 54608767
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
54608864 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
54608767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 9261789 - 9261885
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttggtccctgcaaaatattttg |
9261885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 490 - 585
Target Start/End: Complemental strand, 12741273 - 12741178
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
12741273 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
12741178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 45002020 - 45002076
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45002020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 490 - 585
Target Start/End: Complemental strand, 45002387 - 45002292
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
45002387 |
aaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
45002292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 9603628 - 9603679
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9603628 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
9603679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 21159823 - 21159721
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| || |
|
|
| T |
21159823 |
tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaatttt |
21159724 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
21159723 |
ttg |
21159721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 580
Target Start/End: Original strand, 35565506 - 35565596
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
35565506 |
aaggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgtaattttttgttattgtttttggtccctgcaaa |
35565596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 47005525 - 47005423
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||| | ||| || ||||||||||||||||||||||||| |
|
|
| T |
47005525 |
tttttaggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatatt |
47005426 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
47005425 |
ttg |
47005423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 25615973 - 25616031
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25615973 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
25616031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 46751267 - 46751321
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46751267 |
ttaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
46751321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 4513258 - 4513319
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4513258 |
tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
4513319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 488 - 580
Target Start/End: Complemental strand, 9597099 - 9597007
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
9597099 |
ttaaggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
9597007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 486 - 547
Target Start/End: Complemental strand, 20612904 - 20612843
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20612904 |
ttttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 587
Target Start/End: Original strand, 22008521 - 22008621
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt |
586 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||||||| |||||||||||| |
|
|
| T |
22008521 |
tttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaattgttgtttttggtccttgcaaaatattt |
22008620 |
T |
 |
| Q |
587 |
t |
587 |
Q |
| |
|
| |
|
|
| T |
22008621 |
t |
22008621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 587
Target Start/End: Original strand, 22016039 - 22016139
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt |
586 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||||||| |||||||||||| |
|
|
| T |
22016039 |
tttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaattgttgtttttggtccttgcaaaatattt |
22016138 |
T |
 |
| Q |
587 |
t |
587 |
Q |
| |
|
| |
|
|
| T |
22016139 |
t |
22016139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 26090078 - 26089982
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgtaaaatattttg |
26089982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 54608516 - 54608573
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54608516 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 489 - 588
Target Start/End: Original strand, 474041 - 474140
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
474041 |
taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttggtgtttttggtccctgcaaaatattttg |
474140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 474409 - 474353
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
474409 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 4035053 - 4034997
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgt |
4034997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 585
Target Start/End: Original strand, 8940158 - 8940253
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
8940158 |
aaggttaaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
8940253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 14772205 - 14772261
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
14772205 |
ttttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt |
14772261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 28552384 - 28552328
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28552384 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 489 - 588
Target Start/End: Complemental strand, 35569139 - 35569040
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
35569139 |
taaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg |
35569040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 39288899 - 39288843
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39288899 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 487 - 590
Target Start/End: Complemental strand, 45313868 - 45313765
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt |
586 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| |||||||| ||||||| ||||| || | |||||||||||||||||||||||| |
|
|
| T |
45313868 |
tttatggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaattttagtttttagtttttggtccctgcaaaatattt |
45313769 |
T |
 |
| Q |
587 |
tgat |
590 |
Q |
| |
|
|||| |
|
|
| T |
45313768 |
tgat |
45313765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 487 - 547
Target Start/End: Original strand, 47336223 - 47336283
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
47336223 |
tttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 51550081 - 51550137
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51550081 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 1721454 - 1721356
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
1721454 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaaatttttgtgttgtatttggtccctgcaaaatattttg |
1721356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 3387261 - 3387320
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3387261 |
ttaaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 9262156 - 9262105
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9262156 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
9262105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 22008890 - 22008835
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 43441270 - 43441325
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 48924243 - 48924184
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
48924243 |
taaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgt |
48924184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 4950035 - 4950093
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4950035 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
4950093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 40370589 - 40370539
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
40370539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 51834605 - 51834663
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51834605 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 580
Target Start/End: Original strand, 4034717 - 4034805
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
4034805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 4513625 - 4513564
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
4513625 |
tttaaggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgt |
4513564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 8940527 - 8940470
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8940527 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 10977343 - 10977286
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10977343 |
aaggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg |
10977286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 12740901 - 12740962
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12740901 |
tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 15979702 - 15979606
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
15979702 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatattttg |
15979606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 28427610 - 28427553
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28427610 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 29955667 - 29955610
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29955667 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
29955610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 30004822 - 30004765
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30004822 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
30004765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 30106221 - 30106164
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
30106221 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt |
30106164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 30128283 - 30128340
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
30128283 |
aggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgt |
30128340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 30130157 - 30130214
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30130157 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
30130214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 32119586 - 32119529
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32119586 |
aaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 37507224 - 37507167
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37507224 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 39437111 - 39437054
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39437111 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 584
Target Start/End: Original strand, 40370285 - 40370377
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat |
584 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||| |||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaaatat |
40370377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 44802282 - 44802377
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctg-aaaatattttg |
44802377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 3152112 - 3152056
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3152112 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 3387606 - 3387554
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
3387606 |
aaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagt |
3387554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 585 - 649
Target Start/End: Complemental strand, 14743859 - 14743795
Alignment:
| Q |
585 |
tttgatccgttttacattccttggtttcttcttcctcattagagattggtggtggtgagtaggtg |
649 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || | ||||||| ||||| |||| |
|
|
| T |
14743859 |
tttgatccgttttacattccttggtttcttcttcctcattaaaggtaggtggtgatgagtcggtg |
14743795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 489 - 541
Target Start/End: Original strand, 21553886 - 21553938
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
21553886 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttag |
21553938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 25710870 - 25710814
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
25710814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 485 - 588
Target Start/End: Original strand, 35936773 - 35936876
Alignment:
| Q |
485 |
gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat |
584 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||| | |||||||||||||| | || || || |||||||||||||||||||||||| |
|
|
| T |
35936773 |
gttttaaggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccccgtaatttttttttgttgtttttggtccctgcaaaatat |
35936872 |
T |
 |
| Q |
585 |
tttg |
588 |
Q |
| |
|
|||| |
|
|
| T |
35936873 |
tttg |
35936876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 37506866 - 37506922
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37506866 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 45320983 - 45320923
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45320983 |
ttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45320923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 3151749 - 3151800
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3151749 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3151800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 3830517 - 3830466
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3830517 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3830466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 10976978 - 10977033
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 11463233 - 11463288
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgt |
11463288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 15286155 - 15286206
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagt |
15286206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 15979338 - 15979393
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 26089730 - 26089785
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 29490744 - 29490693
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
29490744 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
29490693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 31480500 - 31480445
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 487 - 542
Target Start/End: Original strand, 39288568 - 39288623
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
39288568 |
tttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
39288623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 494 - 588
Target Start/End: Complemental strand, 45006247 - 45006153
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||| | ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
45006153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 580
Target Start/End: Original strand, 47005152 - 47005242
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
47005152 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgtaatttttttttgttgtttttggtccctgcaaa |
47005242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 313 - 475
Target Start/End: Complemental strand, 4159953 - 4159791
Alignment:
| Q |
313 |
tccctcaccatataaagtaagaatttta--acagtcttgaaccagttcagattatataatccaaacatttcttggtcatgttcggataatatcattcgaa |
410 |
Q |
| |
|
||||||||| || |||||| ||| |||| ||||||||||||||||| || |||||| |||||||||| | || ||||| || |||| |||| || |
|
|
| T |
4159953 |
tccctcaccctaaaaagtatgaactttatcacagtcttgaaccagtttcga--atataaaccaaacatttttgggatgtgttcacattatataattcaaa |
4159856 |
T |
 |
| Q |
411 |
atagttcagagtttcgatggttacttgttcagcaagagtaacttattgaacatgtttttctttgg |
475 |
Q |
| |
|
|||||||| ||||| |||| ||||||| | ||||||| ||||| |||||||| |||||||||||| |
|
|
| T |
4159855 |
atagttcaaagtttggatgattacttgcttagcaagactaactcattgaacacgtttttctttgg |
4159791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 5345691 - 5345633
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
5345691 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
5345633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 493 - 547
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 25610134 - 25610080
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
25610134 |
ttaaagctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
25610080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 27681683 - 27681586
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||||||||||||||||| | ||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
27681683 |
aggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgtaatatttttttgttgtttttgatccctgcaaaatattttg |
27681586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 28452146 - 28452243
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| || |||||||||||||| | ||| || |||||||||||||||||||||||||||| |
|
|
| T |
28452146 |
aggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
28452243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 28942908 - 28942850
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||| |||| |
|
|
| T |
28942908 |
taaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 30268503 - 30268561
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30268503 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30268561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 32119219 - 32119316
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| |||||||| |||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
32119219 |
aggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
32119316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 35177253 - 35177311
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
35177253 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtttctgt |
35177311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 485 - 547
Target Start/End: Original strand, 39436711 - 39436773
Alignment:
| Q |
485 |
gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
39436711 |
gtttaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 40545558 - 40545620
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
40545558 |
tttttaggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt |
40545620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 540
Target Start/End: Complemental strand, 40979712 - 40979662
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
40979712 |
aaggctaaaatatggttttaatccctgcaaatatggctcgttttggtttta |
40979662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 587
Target Start/End: Original strand, 46724545 - 46724638
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| |||||||| |||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46724545 |
ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaaatatttt |
46724638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 50196301 - 50196355
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
50196355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 52342587 - 52342533
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
52342587 |
ttaaggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagt |
52342533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 3830133 - 3830190
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
3830133 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
3830190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 488 - 588
Target Start/End: Complemental strand, 4322193 - 4322093
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||| |||||||| |||||| |||||||||||||| || |||||||||||||| ||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
4322193 |
ttaaggttaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaatttcttttgttgtttttggttcctgcaaaatatttt |
4322094 |
T |
 |
| Q |
588 |
g |
588 |
Q |
| |
|
| |
|
|
| T |
4322093 |
g |
4322093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 540
Target Start/End: Complemental strand, 9603920 - 9603871
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
9603920 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 13584369 - 13584312
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
13584369 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 20611017 - 20611070
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
20611017 |
taaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
20611070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 26799886 - 26799943
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
26799886 |
aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 30034473 - 30034416
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30034473 |
aggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgt |
30034416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 35407791 - 35407734
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||| |||||||| ||||| |
|
|
| T |
35407791 |
aggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgt |
35407734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 40169342 - 40169399
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
40169342 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 52342194 - 52342243
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
52342194 |
aggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 3361824 - 3361768
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
3361824 |
ttttaaagctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
3361768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 7957226 - 7957170
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgt |
7957170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 9863404 - 9863348
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
9863348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 15016388 - 15016444
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
15016444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 16123139 - 16123195
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
16123195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 28452377 - 28452321
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
28452377 |
aggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 543
Target Start/End: Original strand, 28942524 - 28942576
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt |
543 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
28942524 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtt |
28942576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 29445954 - 29446010
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29446010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 29525099 - 29525155
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
29525099 |
ttttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagt |
29525155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 46186773 - 46186721
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
46186773 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
46186721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 47114485 - 47114537
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
47114485 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
47114537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 51834943 - 51834887
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
51834943 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 53701663 - 53701607
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
53701607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 540
Target Start/End: Complemental strand, 2486905 - 2486854
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
2486905 |
taagactaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 540
Target Start/End: Original strand, 4814537 - 4814588
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4814537 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 7588317 - 7588368
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
7588317 |
aggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagt |
7588368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 8510214 - 8510269
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 12673642 - 12673740
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||||||||||||||||||||||| ||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
12673642 |
aaggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgtaaaaataaaattttgtttttggtccctgcaaaattttttg |
12673740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 494 - 541
Target Start/End: Original strand, 14633547 - 14633594
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
14633594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 20907454 - 20907407
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggttttagt |
20907407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 494 - 588
Target Start/End: Original strand, 30034109 - 30034203
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||||||||||||||| | | ||| || |||||||||||||||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
30034203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 34238597 - 34238648
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
34238597 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
34238648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 863280 - 863377
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||| |||||||| |||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
863280 |
aggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
863377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 587
Target Start/End: Original strand, 2486581 - 2486674
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||||||||||| ||| || ||||||||||||| ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagttcatgtaattttatttttttgtttttggtccttgcaaaatatttt |
2486674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 544
Target Start/End: Complemental strand, 7518444 - 7518394
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagttc |
7518394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 29678022 - 29678080
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| |||||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
29678022 |
aaggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgt |
29678080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 29686870 - 29686820
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
29686870 |
ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagt |
29686820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 29955300 - 29955354
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
29955354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 30004454 - 30004508
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
30004508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 31869596 - 31869650
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgt |
31869650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 38232237 - 38232291
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
38232237 |
ttaaggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagt |
38232291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 40277820 - 40277870
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
40277820 |
aaggctaaaatgtggttttggtccctgcaaatatgcttcgttttggtttta |
40277870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 536
Target Start/End: Complemental strand, 44802550 - 44802504
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggt |
536 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
44802550 |
aaggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 20404889 - 20404946
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||| ||||||||||| |||| |
|
|
| T |
20404889 |
aggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagtttctgt |
20404946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 22155923 - 22155984
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
22155923 |
tttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 25609766 - 25609862
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| || | |||||| ||||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
25609766 |
aggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatattttg |
25609862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 488 - 580
Target Start/End: Original strand, 29686540 - 29686632
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||| |||||||||||| ||| |||||||||| || |||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
29686540 |
ttaaggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgtaatatttttttgttgtttttggtccctgcaaa |
29686632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 31869957 - 31869900
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
31869957 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt |
31869900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 488 - 545
Target Start/End: Complemental strand, 36673249 - 36673192
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc |
545 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
36673249 |
ttaacgctaaaatatggttttggtccctgcaaatatgacttattttggttttagttcc |
36673192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 50196658 - 50196601
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
50196658 |
aggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgt |
50196601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 539
Target Start/End: Original strand, 53113441 - 53113490
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
53113441 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 275443 - 275499
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
275443 |
aggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 4814904 - 4814849
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
4814904 |
ttttaaggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagt |
4814849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 7518088 - 7518140
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
7518088 |
aaggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagt |
7518140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 19656539 - 19656591
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||| ||||||| |
|
|
| T |
19656539 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagt |
19656591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 19844265 - 19844321
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| ||||||| ||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgt |
19844321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 20757781 - 20757725
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||| |||| ||||||| |||||||| |||||||||||||||| |
|
|
| T |
20757781 |
tttttaggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagt |
20757725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 21159451 - 21159503
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
21159451 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
21159503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 28427244 - 28427300
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
28427244 |
aggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 34238917 - 34238865
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
34238917 |
aaggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagt |
34238865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 46622130 - 46622074
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
46622130 |
aggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 493 - 541
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 490 - 580
Target Start/End: Complemental strand, 863654 - 863564
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||||| ||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
863654 |
aaggttaaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
863564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 8555305 - 8555258
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagt |
8555258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 9596759 - 9596814
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgt |
9596814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 13514578 - 13514527
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
13514578 |
aggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagt |
13514527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 20757403 - 20757450
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
20757450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 29446207 - 29446156
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
29446207 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
29446156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 40169654 - 40169599
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 51759817 - 51759915
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||| | | |||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
51759817 |
aaggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttg |
51759915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 1721083 - 1721145
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||| ||||||||||||||| ||| |||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
1721083 |
tttttaggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgt |
1721145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 313 - 475
Target Start/End: Complemental strand, 4144141 - 4143979
Alignment:
| Q |
313 |
tccctcaccatataaagtaagaattttaaca--gtcttgaaccagttcagattatataatccaaacatttcttggtcatgttcggataatatcattcgaa |
410 |
Q |
| |
|
||||||||| || |||||| ||| ||||||| |||||||||| |||| | |||||| |||||||||| | || ||||| || |||| |||| || |
|
|
| T |
4144141 |
tccctcaccctaaaaagtatgaactttaacaaggtcttgaaccggttccaa--atataaaccaaacatttttgggatgtgttcacattatataattcaaa |
4144044 |
T |
 |
| Q |
411 |
atagttcagagtttcgatggttacttgttcagcaagagtaacttattgaacatgtttttctttgg |
475 |
Q |
| |
|
||||| || ||||| |||| ||||||| | ||||||| ||||| |||||||| |||||||||||| |
|
|
| T |
4144043 |
atagtccaaagtttggatgattacttgcttagcaagactaactcattgaacacgtttttctttgg |
4143979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 10778368 - 10778426
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10778368 |
aaggttaaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctgt |
10778426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 20644878 - 20644820
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||| || ||||||| ||||||| ||||| |
|
|
| T |
20644878 |
aaggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgt |
20644820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 492 - 545
Target Start/End: Complemental strand, 275833 - 275780
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc |
545 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagttcc |
275780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 4321945 - 4321994
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||| ||| ||||||||||| |
|
|
| T |
4321945 |
aggctaaaatatggttctgatccttgcaaatatgtctcattttggtttta |
4321994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 11463480 - 11463431
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| | || ||||||| ||||||||||||||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagt |
11463431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 14633891 - 14633834
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
| T |
14633891 |
aaggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
14633834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 20405224 - 20405167
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | | ||||| |||||||| ||||| |
|
|
| T |
20405224 |
aggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgt |
20405167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 25710509 - 25710566
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
25710509 |
aggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
25710566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 492 - 541
Target Start/End: Complemental strand, 29678387 - 29678338
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttag |
29678338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 489 - 542
Target Start/End: Complemental strand, 30130507 - 30130454
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||||||| ||||||||||||| |
|
|
| T |
30130507 |
taaggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagt |
30130454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 30552480 - 30552423
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
30552480 |
aaggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 40545836 - 40545783
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgt |
40545783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 45521841 - 45521780
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||| |||||||||||||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
45521841 |
tttaaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt |
45521780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 46186410 - 46186459
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagt |
46186459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 46901103 - 46901160
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
46901103 |
aggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagtttctgt |
46901160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 50009284 - 50009189
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||||||||||||| ||||| | ||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgtaatttttgttt-ttgttttttgtccctgcaaaatattttg |
50009189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 534
Target Start/End: Complemental strand, 53113757 - 53113716
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttg |
534 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
53113757 |
gctaaaatatggttttgatccatgcaaatatacctcgttttg |
53113716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 12673985 - 12673925
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||| ||||||||| |||| | |||||||||||||||| |||||||||||||| |||| |
|
|
| T |
12673985 |
ttaaggttaaaatatgattttagttcctgcaaatatgcctcattttggttttagtttctgt |
12673925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 20644505 - 20644561
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||| ||||| ||||||| ||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgt |
20644561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 21971046 - 21970994
Alignment:
| Q |
496 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| ||| || |||||||||||||||||| |||||||| |||| |
|
|
| T |
21971046 |
aaaatatggttttaatctctacaaatatgcctcgttttgattttagtttctgt |
21970994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 21993482 - 21993430
Alignment:
| Q |
496 |
aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| ||| || |||||||||||||||||| |||||||| |||| |
|
|
| T |
21993482 |
aaaatatggttttaatctctacaaatatgcctcgttttgattttagtttctgt |
21993430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 534
Target Start/End: Original strand, 25353197 - 25353241
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
534 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25353197 |
aaggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 488 - 544
Target Start/End: Original strand, 27200434 - 27200490
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| ||| |||| |||||||||| |
|
|
| T |
27200434 |
ttaaggttaaaatatggttttaatccctgcaaatatatctcattttagttttagttc |
27200490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 489 - 541
Target Start/End: Original strand, 35533276 - 35533328
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||| |||||||||||||||| || ||||||||||| || ||||||||||||| |
|
|
| T |
35533276 |
taagactaaaatatggttttggtctctgcaaatatgtcttgttttggttttag |
35533328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 488 - 548
Target Start/End: Original strand, 36732636 - 36732696
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||| ||||||| ||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
| T |
36732636 |
ttaaggttaaaataaggttttggtccctgcaaatatgtcttattttggttttagtttctgt |
36732696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 39072213 - 39072165
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgatttta |
39072165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 43440493 - 43440545
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||| |||||||| |
|
|
| T |
43440493 |
aaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagt |
43440545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 43440785 - 43440737
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagt |
43440737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 45161107 - 45161163
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||| | ||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
45161107 |
ttttaaagttaaaatatggtttaagtccctgcaaatatgtctcgttttggttttagt |
45161163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 49670803 - 49670747
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccc-tgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 501 - 580
Target Start/End: Complemental strand, 52956691 - 52956612
Alignment:
| Q |
501 |
atggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
||||||||| || |||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
52956691 |
atggttttggtctctgcaaatatgcatcgttttggttttagtttttgtaaattttttttattgtttttggtccctgcaaa |
52956612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 53701361 - 53701417
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| |||| |||||||| ||||| |
|
|
| T |
53701361 |
ggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgt |
53701417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 9863050 - 9863096
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagt |
9863096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 513 - 544
Target Start/End: Complemental strand, 16123481 - 16123450
Alignment:
| Q |
513 |
cctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16123481 |
cctgcaaatatgcctcgttttggttttagttc |
16123450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 487 - 530
Target Start/End: Complemental strand, 26273829 - 26273786
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgt |
530 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
26273829 |
tttaaggctaaaatatggttttagtcccagcaaatatgcctcgt |
26273786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 28418899 - 28418844
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | |||||| ||||||| ||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgt |
28418844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 34582520 - 34582579
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| | |||||||||||||| |||| |
|
|
| T |
34582520 |
ttaaggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
34582579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 36672966 - 36673013
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| || ||||||||||| || |||||||||||||| |
|
|
| T |
36672966 |
taaaatatggttttggtctctgcaaatatgtcttgttttggttttagt |
36673013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 46724901 - 46724846
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| | |||||| ||||||| ||||| |
|
|
| T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgt |
46724846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 51500397 - 51500448
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| | || ||| ||||||||||||||||||||||||| |
|
|
| T |
51500397 |
aggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagt |
51500448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 20644578 - 20644612
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
20644578 |
ttttgatccctgcaaatatgtctcgttttggtttt |
20644612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 30424628 - 30424678
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || ||||| |||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagt |
30424678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 30426226 - 30426177
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| ||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagt |
30426177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 486 - 524
Target Start/End: Complemental strand, 39132912 - 39132874
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatg |
524 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
39132912 |
tttttaggctaaaatatggttttggtccctgcaaatatg |
39132874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 494 - 540
Target Start/End: Original strand, 46621778 - 46621824
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
46621778 |
ctaaaatattgttttgatcccagcaaatatgcctcattttagtttta |
46621824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 513 - 542
Target Start/End: Original strand, 590197 - 590226
Alignment:
| Q |
513 |
cctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
590197 |
cctgcaaatatgcctcgttttggttttagt |
590226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 498 - 547
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
| Q |
498 |
aatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
8510474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 486 - 523
Target Start/End: Complemental strand, 20585709 - 20585672
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatat |
523 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
20585709 |
tttttaggctaaaatatgtttttgatccctgcaaatat |
20585672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 502 - 539
Target Start/End: Complemental strand, 25610061 - 25610024
Alignment:
| Q |
502 |
tggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggtttt |
25610024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 495 - 540
Target Start/End: Complemental strand, 35177563 - 35177518
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| || ||||||||||| |
|
|
| T |
35177563 |
taaaatatggttttcatccttgcaaatatgcttccttttggtttta |
35177518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 505 - 542
Target Start/End: Original strand, 35565581 - 35565618
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagt |
35565618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 490 - 543
Target Start/End: Complemental strand, 40279337 - 40279284
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt |
543 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| || |||||| |||||||| |
|
|
| T |
40279337 |
aaggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagtt |
40279284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 47114804 - 47114747
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
47114804 |
aggctaaaatatagttttggtccttgcaaatatatttcgttttagttttagttcctgt |
47114747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 54767524 - 54767471
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| ||||| ||||||| ||||||||| ||||||| ||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgt |
54767471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 4e-25; HSPs: 200)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 24507845 - 24507747
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
24507845 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattttg |
24507747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 489 - 588
Target Start/End: Complemental strand, 12360971 - 12360872
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
12360971 |
taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttg |
12360872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 3247196 - 3247294
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
3247196 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
3247294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 19720710 - 19720808
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
19720710 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
19720808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 38164297 - 38164199
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
38164297 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
38164199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 47819598 - 47819500
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
47819598 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
47819500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 8140433 - 8140530
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
8140433 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
8140530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 492 - 585
Target Start/End: Complemental strand, 38151212 - 38151119
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
38151119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 24653802 - 24653898
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
24653898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 493 - 588
Target Start/End: Original strand, 44157696 - 44157791
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttagtccctgcaaaatattttg |
44157791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 584
Target Start/End: Complemental strand, 8140805 - 8140707
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat |
584 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
8140805 |
ttttaaggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatat |
8140707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 492 - 590
Target Start/End: Original strand, 10631164 - 10631262
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttgat |
590 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||| ||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgat |
10631262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 15526364 - 15526266
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
15526364 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg |
15526266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 24507479 - 24507534
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 30322927 - 30323025
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
30322927 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg |
30323025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 10887599 - 10887502
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||| | || |||||||||||||||||||||||||||| |
|
|
| T |
10887599 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
10887502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 19623020 - 19622962
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19623020 |
taaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 492 - 585
Target Start/End: Original strand, 33000305 - 33000398
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
33000398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 33045692 - 33045634
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33045692 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
33045634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 35307713 - 35307771
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35307713 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
35307771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 45638895 - 45638798
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| ||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
45638895 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcctataaaaaaaaattgttgtttttggtccctgcaaaatattttg |
45638798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 35056530 - 35056626
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
35056626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 40718110 - 40718206
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg |
40718206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 45380636 - 45380540
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg |
45380540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 489 - 588
Target Start/End: Original strand, 29072494 - 29072593
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
29072494 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttg |
29072593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 29688430 - 29688378
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29688430 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
29688378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 47819231 - 47819287
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47819231 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 52254181 - 52254233
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52254181 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
52254233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 24978124 - 24978026
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
24978124 |
aaggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgtaaattttttttgttgtttttggtccttgcaaaatattttg |
24978026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 1810925 - 1810983
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1810925 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
1810983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 587
Target Start/End: Original strand, 8364614 - 8364711
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
8364614 |
aaggttaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgtaatttttttttgttgtttttggtccctgcaaaatatttt |
8364711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 544
Target Start/End: Complemental strand, 15058768 - 15058714
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15058768 |
aaggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagttc |
15058714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 587
Target Start/End: Original strand, 15211509 - 15211606
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||||||||||| |||| || ||||||||||||||||||||||||||| |
|
|
| T |
15211509 |
aaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgtaaatttttgttgttgtttttggtccctgcaaaatatttt |
15211606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 17129691 - 17129745
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgt |
17129745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 18302393 - 18302331
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18302393 |
ttttgaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
18302331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 18899833 - 18899895
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18899833 |
ttttaaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
18899895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 26324584 - 26324681
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||| ||| |||||||||||||| |
|
|
| T |
26324584 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttgatccttgcaaaatattttg |
26324681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 31061154 - 31061096
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31061154 |
taaggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 32626527 - 32626585
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32626527 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
32626585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 32729052 - 32728994
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32729052 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 33234544 - 33234602
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
33234544 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
33234602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 39747836 - 39747739
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||| ||| |||||||||||||| |
|
|
| T |
39747836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttgatccttgcaaaatattttg |
39747739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 45368488 - 45368546
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45368488 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45368546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Complemental strand, 3247568 - 3247507
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3247568 |
tttttaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 10631530 - 10631473
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
10631530 |
aaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 13770488 - 13770545
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13770488 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
13770545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 22919683 - 22919740
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22919683 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
22919740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 26061954 - 26062011
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26061954 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 31060787 - 31060883
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg |
31060883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 33000671 - 33000614
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
33000671 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 38163929 - 38163986
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38163929 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 990380 - 990324
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
990380 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 11822002 - 11822054
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11822002 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
11822054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 15516581 - 15516637
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
15516581 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 16026939 - 16026883
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
16026939 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 16060885 - 16060829
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
16060829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 18473271 - 18473327
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18473271 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 18473597 - 18473545
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18473597 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18473545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 30323294 - 30323238
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30323294 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 33379886 - 33379938
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33379886 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
33379938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 35005750 - 35005694
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35005750 |
tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35005694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 35056895 - 35056839
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35056895 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 35308111 - 35308055
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
35308055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 41358368 - 41358424
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 41358664 - 41358608
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41358664 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 45380271 - 45380327
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45380271 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 497 - 548
Target Start/End: Original strand, 2939934 - 2939985
Alignment:
| Q |
497 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt |
2939985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 3753214 - 3753269
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3753269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 5058994 - 5058896
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||||||||||||| ||||||| ||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
5058994 |
aaggttaaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgtaaatttttgttgttgtttttgggccctgcaaaatattttg |
5058896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 7001897 - 7001842
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 7819104 - 7819053
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
7819104 |
aggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagt |
7819053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 12361008 - 12361067
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
12361008 |
taaggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgt |
12361067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 18928148 - 18928046
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||| ||||||||||||||||| || ||||||||||| ||| |||| |||||||| || || |||||||||||||||||||||||||||| |
|
|
| T |
18928148 |
ttttaaagctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtcccggtaacatttttttattgtttttggtccctgcaaaatatt |
18928049 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
18928048 |
ttg |
18928046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 541
Target Start/End: Complemental strand, 24654169 - 24654118
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
24654169 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
24654118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 24977778 - 24977833
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 31258335 - 31258394
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31258335 |
ttaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 38136981 - 38136926
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 45638580 - 45638635
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 46868577 - 46868522
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 990085 - 990143
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
990085 |
taaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 3679624 - 3679682
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
3679624 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
3679682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 3753574 - 3753516
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
3753574 |
aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
3753516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 4789310 - 4789364
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
4789364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 6567498 - 6567440
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
6567498 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
6567440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 585
Target Start/End: Complemental strand, 12322970 - 12322877
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| | ||||| || ||||||||||||| ||||||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgtaaatttttgttgttgtttttggtccttgcaaaatatt |
12322877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 495 - 588
Target Start/End: Complemental strand, 15335292 - 15335199
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaataaaaattttgtttttggtccctgcaaaattttttg |
15335199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 26442901 - 26442843
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
26442901 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgt |
26442843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 544
Target Start/End: Complemental strand, 42483277 - 42483219
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| | ||||||||||| |||| |
|
|
| T |
42483277 |
ttttaaggctaaaatatggttttggtccctgcaaatatgctttgttttggttttggttc |
42483219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 10887227 - 10887288
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
10887227 |
tttttaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 14007488 - 14007545
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14007545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 15058419 - 15058468
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagt |
15058468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 21391095 - 21391152
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
21391095 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
21391152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 492 - 541
Target Start/End: Original strand, 24649350 - 24649399
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
24649399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 32454295 - 32454238
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
32454295 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgt |
32454238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 33045354 - 33045411
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
33045354 |
aggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgt |
33045411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 33234912 - 33234816
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| ||||||| ||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaatttttgtgttgtttttgatccctgcaaaatattttg |
33234816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 35005442 - 35005499
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
35005442 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 37545622 - 37545683
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
37545622 |
ttttatggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 38150846 - 38150903
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
38150846 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 44641079 - 44641128
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
44641128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 44641437 - 44641376
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44641437 |
tttatggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
44641376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 45290455 - 45290512
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45290455 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 48956066 - 48955970
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttg |
48955970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 50429210 - 50429153
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50429210 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
50429153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 50799129 - 50799186
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
50799129 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
50799186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 13260322 - 13260266
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13260322 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 16060594 - 16060645
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
16060594 |
aaggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagt |
16060645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 17984331 - 17984383
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17984331 |
aaggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagt |
17984383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 19622649 - 19622705
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
19622649 |
tttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19622705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 22953556 - 22953500
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagatcctgt |
22953500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 29072862 - 29072806
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgt |
29072806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 41738796 - 41738852
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgt |
41738852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 589
Target Start/End: Original strand, 42482978 - 42483077
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnnttattgtttttggtccctgcaaaatattttga |
589 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
42482978 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttga |
42483077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 44158044 - 44157992
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
44158044 |
aaggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagt |
44157992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 45290821 - 45290765
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
45290821 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 494 - 542
Target Start/End: Original strand, 46183686 - 46183734
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt |
46183734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 52254479 - 52254423
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
52254423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 7818783 - 7818838
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtttctgt |
7818838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 19198948 - 19198893
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||| ||||||| ||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgt |
19198893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 41881089 - 41881148
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
41881089 |
ttaaggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 48609595 - 48609544
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
48609595 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48609544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 48955713 - 48955764
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48955713 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
48955764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 7867359 - 7867301
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || ||||||||||||| ||||| |
|
|
| T |
7867359 |
aaggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgt |
7867301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 12322604 - 12322654
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagt |
12322654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 541
Target Start/End: Original strand, 12360602 - 12360652
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||| ||||||| |
|
|
| T |
12360602 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttagttttag |
12360652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 538
Target Start/End: Complemental strand, 15211858 - 15211812
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
15211812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 540
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 17984701 - 17984651
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
17984651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 18079396 - 18079454
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||||||| ||||||||||||| ||||| |
|
|
| T |
18079396 |
aaggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgt |
18079454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 25658299 - 25658245
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
25658299 |
ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgt |
25658245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 26191359 - 26191409
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
26191409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 26191734 - 26191684
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
26191684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 26207280 - 26207334
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt |
26207334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 26442563 - 26442613
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
26442613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 28507459 - 28507362
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| ||| |||| |||||||| ||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
28507459 |
aggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgtaattttttatttttgtttttggtccctgcaaaacattttg |
28507362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 493 - 547
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 34002942 - 34002884
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
34002942 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgt |
34002884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 489 - 539
Target Start/End: Original strand, 37624743 - 37624793
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
37624743 |
taaggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 39025381 - 39025332
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagt |
39025332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 586
Target Start/End: Complemental strand, 41739121 - 41739029
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt |
586 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
41739121 |
aggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgtaaatttttgtttttgtttttggtccctgcaaaatattt |
41739029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 48609234 - 48609292
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
48609234 |
aaggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgt |
48609292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 49073689 - 49073739
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
49073689 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
49073739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 4323829 - 4323878
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
4323878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 11822366 - 11822309
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
11822366 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgt |
11822309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 13259987 - 13260044
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
13259987 |
aggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgt |
13260044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 18900130 - 18900077
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt |
18900077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 24649661 - 24649604
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
24649661 |
aggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
24649604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 3679986 - 3679930
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt |
3679930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 7350417 - 7350473
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
7350417 |
ttttaaggttaaaatatggttttagtccctgcaaatatgtctcattttggttttagt |
7350473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 331
Target Start/End: Original strand, 15500090 - 15500289
Alignment:
| Q |
129 |
tagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttatagaagattatgtgtg |
228 |
Q |
| |
|
||||||||||| |||| |||| | | ||||||||| | ||||||||||||||||| |||||| |||| ||| | |||||||||||| || |||||| |
|
|
| T |
15500090 |
tagtttggtgtctagataaatgactaaagtgtccatggtgatttggtgtggtttaaacaatatgaaaacaagcaaacaaatttatagaagtttttgtgtg |
15500189 |
T |
 |
| Q |
229 |
tcgtggatcacaaaatatgtcggtgcaagacgaacatagaaaaaatcatgaactgaatagtttcaaattatataatttgagccctccctcaccatataaa |
328 |
Q |
| |
|
|||| || ||| || ||||||| ||| | || | |||| |||||| ||| ||||| |||| ||| || |||||| ||||||||||||||||||| |
|
|
| T |
15500190 |
tcgtagaccacctaaactgtcggtacaatgc---cacataaaatatcatgtacttaataggttcatattttaacatttgaaccctccctcaccatataaa |
15500286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 16026571 - 16026623
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
16026571 |
aaggctaaaatataattttggtccctgcaaatatccctcgttttggttttagt |
16026623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 534
Target Start/End: Complemental strand, 18079662 - 18079618
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
534 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18079662 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 20948755 - 20948811
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||| ||||||||| ||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgt |
20948811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 540
Target Start/End: Original strand, 25658014 - 25658062
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| ||||||||||||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
25658062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 498 - 542
Target Start/End: Original strand, 32035442 - 32035486
Alignment:
| Q |
498 |
aatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
32035442 |
aatatggttttgatctctgcaaatatgtctcgttttggttttagt |
32035486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 48730615 - 48730567
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagt |
48730567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 7350733 - 7350686
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagt |
7350686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 7867123 - 7867225
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||| |||||||||||||||||| ||| |||||||||| |||||||| |||||||| ||||| || ||||||| |||||||||||| |||| |
|
|
| T |
7867123 |
tttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaaattttttttgttgttttcggtccctgcaaattatt |
7867222 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
7867223 |
ttg |
7867225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||||||||||| |||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 22674202 - 22674253
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||| ||||||||||||||||| |
|
|
| T |
22674202 |
aggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagt |
22674253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 22919978 - 22919927
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
22919978 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagt |
22919927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 26324948 - 26324897
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
26324948 |
aggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagt |
26324897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 27521577 - 27521632
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
27521632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 534
Target Start/End: Original strand, 36912852 - 36912895
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
534 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
36912852 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 39303675 - 39303730
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| ||||||||| |||| ||||||||||||||||| ||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgt |
39303730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 39747470 - 39747528
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| | ||||||||||||||||| |||| |
|
|
| T |
39747470 |
ttaaggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 40718474 - 40718419
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | |||||| ||||||| |||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 489 - 539
Target Start/End: Original strand, 39025106 - 39025156
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
39025106 |
taaggttaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
39025156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 45368847 - 45368793
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgt |
45368793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 4565337 - 4565280
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
4565337 |
aggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgt |
4565280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 15334916 - 15334965
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| ||| ||| ||||||| ||||||||||||||| |
|
|
| T |
15334916 |
aggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 16083044 - 16083097
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| |||||||| |||||||| |
|
|
| T |
16083044 |
taaggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagt |
16083097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 21383103 - 21383160
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
21383103 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt |
21383160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 21383429 - 21383372
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||||||| ||||| ||||||| ||||| |
|
|
| T |
21383429 |
aggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgt |
21383372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 26062260 - 26062203
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||| |||||||||||||| |||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
26062260 |
aaggttaaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctg |
26062203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 534
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttg |
534 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 539
Target Start/End: Original strand, 34002633 - 34002682
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
34002633 |
aaggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 34808200 - 34808253
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgt |
34808253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 49923819 - 49923762
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||| ||||| || |||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
49923819 |
aggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgt |
49923762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 489 - 541
Target Start/End: Complemental strand, 4360629 - 4360577
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag |
541 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
4360629 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttag |
4360577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 539
Target Start/End: Complemental strand, 8364917 - 8364869
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||| |||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
8364917 |
aggctaaaatatagttttggtccccgcaaatatgtctcgttttggtttt |
8364869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 21391376 - 21391324
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||| |||||||| |
|
|
| T |
21391376 |
aaggttaaaatatggttttagtccctgtaaatatgcctcgttttagttttagt |
21391324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 539
Target Start/End: Original strand, 33067347 - 33067395
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
33067347 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 103 - 226
Target Start/End: Original strand, 11896310 - 11896432
Alignment:
| Q |
103 |
tttcccccgttgtggtatatttcacttagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacataca |
202 |
Q |
| |
|
|||||||| |||| ||| | | || |||||||||||| |||||||||| || |||| |||||||||||||||||||||| | || |||| |||| || |
|
|
| T |
11896310 |
tttcccccattgtagtaaactacagttagtttggtgt-cagatcaatgattgaagtgttcatgattatttggtgtggtttatagcaaatgaaaacaagca |
11896408 |
T |
 |
| Q |
203 |
agctaatttatagaagattatgtg |
226 |
Q |
| |
|
| |||||||||||| ||||||| |
|
|
| T |
11896409 |
caccaatttatagaagtttatgtg |
11896432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 26142419 - 26142470
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| ||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
26142419 |
aggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagt |
26142470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 26699607 - 26699557
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| ||||||| |||||||| |
|
|
| T |
26699607 |
aggctaaaatatggttttggtcc-tgcaaatatgcttcgtttttgttttagt |
26699557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 33067729 - 33067674
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctgt |
33067674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 33380257 - 33380206
Alignment:
| Q |
492 |
ggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| | |||| |||||||||||||||||||||||||| |
|
|
| T |
33380257 |
ggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagt |
33380206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Complemental strand, 7350663 - 7350629
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7350663 |
ttttggtccctgcaaatatgcctcgttttggtttt |
7350629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 20756015 - 20756069
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||| ||||||||| |||| |||| || ||||||| ||||||||||||||||| |
|
|
| T |
20756015 |
ttaaggttaaaatatgattttaatccttgtaaatatgtctcgttttggttttagt |
20756069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28507188 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28507222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 491 - 533
Target Start/End: Complemental strand, 32035789 - 32035747
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgtttt |
533 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
32035789 |
aggctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 50428872 - 50428969
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||| ||||| | ||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgtaaaaaaatatatttgtttttggtccctgcaaaattttttg |
50428969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 501 - 542
Target Start/End: Original strand, 292868 - 292909
Alignment:
| Q |
501 |
atggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagt |
292909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 497 - 542
Target Start/End: Complemental strand, 16083394 - 16083349
Alignment:
| Q |
497 |
aaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| ||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagt |
16083349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 548
Target Start/End: Original strand, 18302072 - 18302109
Alignment:
| Q |
511 |
tccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18302072 |
tccctgcaaatatgtctcgttttggttttagtccctgt |
18302109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 34382948 - 34382996
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagt |
34382996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 55; Significance: 3e-22; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 82707 - 82610
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
82707 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg |
82610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 82335 - 82396
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
82335 |
ttttaaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 55; Significance: 3e-22; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 75358 - 75455
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
75358 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg |
75455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 75765 - 75709
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
75765 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 51; Significance: 9e-20; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 27365 - 27268
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
27365 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttgatccctgcaaaatattttg |
27268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 27072 - 27106
Alignment:
| Q |
505 |
ttttgatccctgcaaatatgcctcgttttggtttt |
539 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggtttt |
27106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 50; Significance: 3e-19; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 366278 - 366217
Alignment:
| Q |
487 |
tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
366278 |
tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
366217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 365979 - 366035
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgt |
366035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 49; Significance: 1e-18; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 585
Target Start/End: Original strand, 54813 - 54908
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
54813 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
54908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 48; Significance: 5e-18; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 2775 - 2834
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2775 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
2834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 48; Significance: 5e-18; HSPs: 2)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 22061 - 21959
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt |
585 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||| | ||| || ||||||||| ||||||||||||||| |
|
|
| T |
22061 |
ttttaaggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgtaatttttttttgttgtttttgatccctgcaaaatatt |
21962 |
T |
 |
| Q |
586 |
ttg |
588 |
Q |
| |
|
||| |
|
|
| T |
21961 |
ttg |
21959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 524
Target Start/End: Original strand, 21694 - 21728
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatg |
524 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21694 |
aaggctaaaatatggttttgatccctgcaaatatg |
21728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 46; Significance: 8e-17; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 8541 - 8602
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8541 |
ttttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 46; Significance: 8e-17; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 14696 - 14753
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14696 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 15013 - 14956
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt |
14956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 46; Significance: 8e-17; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 3292 - 3235
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3292 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
3235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 46; Significance: 8e-17; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 47923 - 47980
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
47923 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 48228 - 48181
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
48181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 485 - 542
Target Start/End: Complemental strand, 223179 - 223122
Alignment:
| Q |
485 |
gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
223179 |
gtttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagt |
223122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 46; Significance: 8e-17; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 148282 - 148186
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| || || ||||||||||| ||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttttttttggtcccagcaaaatattttg |
148186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 147888 - 147937
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
147888 |
aaggctaaaatatggttttg-tccctgcaaatat--ctcgttttagttttagt |
147937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 2666 - 2610
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
2666 |
tttttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagt |
2610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 2333 - 2382
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
2333 |
aggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 9028 - 8972
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
8972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 8734 - 8788
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
8788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 45; Significance: 3e-16; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 4290 - 4238
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
4290 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
4238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 19472 - 19420
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
19472 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
19420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 4040 - 4091
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4040 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
4091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 19222 - 19273
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
19222 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 2500 - 2551
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
2500 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagt |
2551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 534
Target Start/End: Complemental strand, 2883 - 2841
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttg |
534 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
2841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 5207 - 5257
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5207 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 5227 - 5277
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5227 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 292 - 234
Alignment:
| Q |
489 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
292 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 3920 - 3862
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
3920 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
3862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 3532 - 3582
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
3582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 1309 - 1366
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
1309 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 1646 - 1589
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1646 |
aaggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg |
1589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 35085 - 35028
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| ||||||||||||||||| ||||| |
|
|
| T |
35085 |
aggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgt |
35028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 587
Target Start/End: Original strand, 34724 - 34816
Alignment:
| Q |
495 |
taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
||||||||||||||| | ||||||||||||| || ||||| ||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
34724 |
taaaatatggttttgtttcctgcaaatatgcttcattttgattttaattcctgtaatttttttttgttgtttttggtccctgcaaaatatttt |
34816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 12182 - 12278
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg |
588 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttg |
12278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 12536 - 12486
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
12486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 10516 - 10459
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
10516 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt |
10459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 10168 - 10218
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
10218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 3)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 544
Target Start/End: Original strand, 189328 - 189381
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc |
544 |
Q |
| |
|
|||||||||||| |||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
189328 |
aggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagttc |
189381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 490 - 540
Target Start/End: Complemental strand, 189680 - 189630
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
189680 |
aaggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta |
189630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 61630 - 61687
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| |||||| ||||||| |||| |
|
|
| T |
61630 |
aaggctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccctg |
61687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 5397 - 5449
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
5397 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
5449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 488 - 547
Target Start/End: Complemental strand, 5712 - 5653
Alignment:
| Q |
488 |
ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
| T |
5712 |
ttaaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 34931 - 34986
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 39; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 538
Target Start/End: Complemental strand, 4312 - 4266
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt |
538 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 499 - 547
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
499 |
atatggttttgatccctgcaaatatgcctcgttttggttttagttcctg |
547 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 12525 - 12575
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
12575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 18049 - 17987
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| |||||||||||||||||| ||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
18049 |
tttttaggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgt |
17987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 39; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 580
Target Start/End: Original strand, 94056 - 94145
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa |
580 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| | ||||| || |||||||||||||||||||| |
|
|
| T |
94056 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaaatttttgtttttgtttttggtccctgcaaa |
94145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 540
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
493 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 24371 - 24428
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
24371 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 38; Significance: 0.000000000005; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 3751 - 3800
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
3751 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggtttta |
3800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 587
Target Start/End: Complemental strand, 4080 - 3984
Alignment:
| Q |
491 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt |
587 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| |||||||| |||||||| || | || ||||||||||||||||||||||||||| |
|
|
| T |
4080 |
aggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtctctatgaaaattttttgttgtttttggtccctgcaaaatatttt |
3984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 16724 - 16780
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgt |
16780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 17966 - 17910
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt |
17910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 8328 - 8380
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
8328 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 8644 - 8592
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
8644 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 5072 - 5014
Alignment:
| Q |
490 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt |
548 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||| |||||||||||||||||| |||| |
|
|
| T |
5072 |
aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagtttctgt |
5014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 486 - 540
Target Start/End: Complemental strand, 7270 - 7216
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
|||||||||||||||||| ||||| || ||||||||||| || |||||||||||| |
|
|
| T |
7270 |
ttttaaggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta |
7216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 494 - 546
Target Start/End: Original strand, 17126 - 17178
Alignment:
| Q |
494 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct |
546 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| | |||||||||||||||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagttcct |
17178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
540 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || ||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
| Q |
492 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
542 |
Q |
| |
|
||||||||||| ||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 486 - 523
Target Start/End: Original strand, 9916 - 9953
Alignment:
| Q |
486 |
ttttaaggctaaaatatggttttgatccctgcaaatat |
523 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
9916 |
tttttaggctaaaatatgcttttgatccctgcaaatat |
9953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University