View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4920-Insertion-3 (Length: 811)

Name: NF4920-Insertion-3
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4920-Insertion-3
NF4920-Insertion-3
[»] chr2 (178 HSPs)
chr2 (8-811)||(32475608-32476419)
chr2 (585-732)||(39923732-39923881)
chr2 (486-588)||(29859776-29859878)
chr2 (487-585)||(2481464-2481562)
chr2 (488-588)||(15842727-15842827)
chr2 (491-590)||(16523227-16523326)
chr2 (490-588)||(14003646-14003744)
chr2 (490-588)||(25705083-25705181)
chr2 (486-588)||(33575746-33575848)
chr2 (491-588)||(1138263-1138360)
chr2 (487-580)||(4423890-4423983)
chr2 (491-588)||(13215059-13215156)
chr2 (491-588)||(24358615-24358712)
chr2 (490-582)||(4042608-4042699)
chr2 (492-588)||(20131585-20131681)
chr2 (490-547)||(24358890-24358947)
chr2 (493-588)||(42696107-42696202)
chr2 (489-548)||(16522988-16523047)
chr2 (486-588)||(40125193-40125295)
chr2 (490-548)||(8046327-8046385)
chr2 (492-588)||(146594-146690)
chr2 (491-587)||(16673676-16673772)
chr2 (487-548)||(33732857-33732918)
chr2 (492-580)||(40124966-40125054)
chr2 (489-580)||(18113086-18113177)
chr2 (486-542)||(22881607-22881663)
chr2 (491-547)||(25705394-25705450)
chr2 (489-580)||(36815747-36815838)
chr2 (492-547)||(4794130-4794185)
chr2 (492-547)||(5334751-5334806)
chr2 (492-547)||(5334985-5335040)
chr2 (493-548)||(10374775-10374830)
chr2 (487-542)||(17541726-17541781)
chr2 (490-588)||(43672222-43672320)
chr2 (490-548)||(4424129-4424187)
chr2 (485-547)||(14003402-14003464)
chr2 (489-547)||(16900151-16900209)
chr2 (489-547)||(16993542-16993600)
chr2 (490-548)||(24483835-24483893)
chr2 (489-547)||(37272047-37272105)
chr2 (494-547)||(146328-146381)
chr2 (491-588)||(11788321-11788417)
chr2 (490-547)||(19184096-19184153)
chr2 (486-547)||(20131311-20131372)
chr2 (490-547)||(26814174-26814231)
chr2 (494-587)||(29182348-29182440)
chr2 (490-547)||(30215420-30215477)
chr2 (485-542)||(31644834-31644891)
chr2 (490-547)||(33576062-33576119)
chr2 (492-580)||(34317798-34317886)
chr2 (490-547)||(37271737-37271794)
chr2 (491-588)||(37910755-37910851)
chr2 (490-547)||(38980198-38980255)
chr2 (487-548)||(43671929-43671990)
chr2 (491-548)||(44559061-44559118)
chr2 (491-548)||(44985928-44985985)
chr2 (492-548)||(9195054-9195110)
chr2 (495-547)||(15842464-15842516)
chr2 (488-548)||(20939269-20939329)
chr2 (495-547)||(29859490-29859542)
chr2 (488-540)||(37911072-37911124)
chr2 (491-547)||(41451836-41451892)
chr2 (487-547)||(44073752-44073812)
chr2 (490-588)||(11713749-11713847)
chr2 (492-582)||(23732039-23732129)
chr2 (489-548)||(38731826-38731885)
chr2 (490-588)||(40301973-40302071)
chr2 (491-542)||(43788857-43788908)
chr2 (494-548)||(1137983-1138037)
chr2 (491-580)||(10671629-10671718)
chr2 (490-548)||(17302087-17302145)
chr2 (492-542)||(27109073-27109123)
chr2 (490-548)||(31225713-31225771)
chr2 (491-588)||(36815487-36815584)
chr2 (491-588)||(40302243-40302340)
chr2 (490-548)||(42358697-42358755)
chr2 (492-542)||(42695868-42695918)
chr2 (494-548)||(44985623-44985677)
chr2 (491-548)||(9195150-9195207)
chr2 (490-547)||(16673409-16673466)
chr2 (490-547)||(17541380-17541437)
chr2 (490-547)||(19183780-19183837)
chr2 (491-548)||(26707872-26707929)
chr2 (495-548)||(35686282-35686335)
chr2 (496-588)||(36806800-36806892)
chr2 (491-548)||(43592045-43592102)
chr2 (491-548)||(43597153-43597210)
chr2 (486-547)||(43789137-43789198)
chr2 (490-542)||(3172018-3172070)
chr2 (490-542)||(3172482-3172534)
chr2 (492-548)||(3671136-3671192)
chr2 (493-588)||(3838168-3838263)
chr2 (492-548)||(8046592-8046648)
chr2 (492-548)||(11713485-11713541)
chr2 (492-587)||(18113359-18113454)
chr2 (490-538)||(23732282-23732330)
chr2 (486-542)||(23989832-23989888)
chr2 (490-538)||(27310874-27310922)
chr2 (490-538)||(29831812-29831860)
chr2 (492-540)||(31226029-31226077)
chr2 (492-540)||(33733193-33733241)
chr2 (492-548)||(36622250-36622306)
chr2 (490-542)||(37228731-37228783)
chr2 (492-548)||(41693947-41694003)
chr2 (494-542)||(44559359-44559407)
chr2 (490-542)||(44994011-44994063)
chr2 (494-588)||(1497849-1497943)
chr2 (492-547)||(5790558-5790613)
chr2 (492-547)||(5790844-5790899)
chr2 (485-548)||(7814681-7814744)
chr2 (491-542)||(10671891-10671942)
chr2 (492-547)||(26813866-26813921)
chr2 (491-542)||(27311019-27311070)
chr2 (493-548)||(29865222-29865277)
chr2 (491-588)||(30215774-30215872)
chr2 (490-588)||(31326156-31326254)
chr2 (491-542)||(31909429-31909479)
chr2 (491-542)||(38639411-38639462)
chr2 (490-588)||(39367664-39367762)
chr2 (492-542)||(4042840-4042890)
chr2 (490-548)||(10665238-10665296)
chr2 (492-542)||(34318033-34318083)
chr2 (494-548)||(36622528-36622582)
chr2 (486-548)||(40786454-40786516)
chr2 (490-548)||(41693672-41693730)
chr2 (495-548)||(1295491-1295544)
chr2 (490-547)||(2481191-2481248)
chr2 (491-548)||(3671002-3671059)
chr2 (490-547)||(7814244-7814301)
chr2 (492-588)||(12835325-12835421)
chr2 (491-548)||(13850521-13850578)
chr2 (491-548)||(20658060-20658117)
chr2 (491-548)||(29865455-29865512)
chr2 (492-541)||(34964110-34964159)
chr2 (487-548)||(43710652-43710713)
chr2 (492-548)||(1497610-1497666)
chr2 (488-548)||(2265341-2265401)
chr2 (492-540)||(10375021-10375069)
chr2 (491-539)||(13215318-13215366)
chr2 (488-548)||(16968548-16968608)
chr2 (491-539)||(20658362-20658410)
chr2 (491-547)||(26239105-26239161)
chr2 (492-548)||(38231431-38231487)
chr2 (488-548)||(43597443-43597503)
chr2 (495-542)||(3832587-3832634)
chr2 (495-542)||(13850834-13850881)
chr2 (495-542)||(17912761-17912808)
chr2 (493-548)||(24483401-24483456)
chr2 (489-548)||(25954370-25954429)
chr2 (487-542)||(38231771-38231826)
chr2 (490-548)||(3837931-3837989)
chr2 (490-548)||(5006605-5006663)
chr2 (490-548)||(26238811-26238869)
chr2 (490-548)||(35155563-35155621)
chr2 (494-548)||(41791020-41791074)
chr2 (492-538)||(41791266-41791312)
chr2 (497-542)||(4794423-4794468)
chr2 (493-542)||(4842865-4842914)
chr2 (491-548)||(10664983-10665040)
chr2 (487-548)||(19831503-19831564)
chr2 (491-540)||(32691312-32691361)
chr2 (489-542)||(45442646-45442699)
chr2 (494-546)||(25299987-25300038)
chr2 (490-542)||(25954113-25954165)
chr2 (492-548)||(31325920-31325976)
chr2 (498-542)||(35155298-35155342)
chr2 (495-543)||(37228991-37229039)
chr2 (495-542)||(17912452-17912499)
chr2 (495-542)||(23990146-23990193)
chr2 (488-542)||(14393079-14393132)
chr2 (494-548)||(25299747-25299801)
chr2 (505-539)||(29831885-29831919)
chr2 (487-540)||(13802481-13802534)
chr2 (511-540)||(16900100-16900129)
chr2 (511-540)||(16993491-16993520)
chr2 (511-548)||(22881912-22881949)
chr2 (493-542)||(34963796-34963845)
chr2 (491-540)||(45442315-45442364)
[»] chr5 (165 HSPs)
chr5 (589-721)||(2059225-2059361)
chr5 (490-585)||(19685287-19685382)
chr5 (490-588)||(1381245-1381343)
chr5 (491-585)||(24443651-24443745)
chr5 (490-588)||(40764684-40764782)
chr5 (486-548)||(28871938-28872000)
chr5 (488-584)||(5917368-5917464)
chr5 (492-588)||(35928362-35928458)
chr5 (485-588)||(29692737-29692840)
chr5 (487-547)||(40764410-40764470)
chr5 (488-547)||(1381556-1381615)
chr5 (486-588)||(5614434-5614536)
chr5 (490-588)||(19565465-19565563)
chr5 (490-588)||(20985993-20986091)
chr5 (491-585)||(37271358-37271452)
chr5 (491-588)||(5917125-5917222)
chr5 (491-588)||(35876956-35877053)
chr5 (490-548)||(38170512-38170570)
chr5 (492-588)||(30888160-30888256)
chr5 (490-547)||(35928062-35928119)
chr5 (485-588)||(45131-45234)
chr5 (491-582)||(1104857-1104948)
chr5 (491-547)||(1105093-1105149)
chr5 (493-588)||(2636898-2636992)
chr5 (491-547)||(19565776-19565832)
chr5 (490-542)||(20660946-20660998)
chr5 (490-588)||(2217492-2217590)
chr5 (492-547)||(6912497-6912552)
chr5 (490-588)||(18258431-18258529)
chr5 (490-588)||(26071521-26071618)
chr5 (488-542)||(4203452-4203506)
chr5 (491-588)||(5904007-5904104)
chr5 (486-548)||(5950170-5950232)
chr5 (494-587)||(6912762-6912855)
chr5 (490-548)||(7075570-7075628)
chr5 (492-585)||(20661218-20661311)
chr5 (490-548)||(21124911-21124969)
chr5 (489-547)||(24443377-24443435)
chr5 (490-548)||(28863508-28863566)
chr5 (489-547)||(29151796-29151854)
chr5 (489-547)||(29172831-29172889)
chr5 (489-547)||(29875397-29875455)
chr5 (490-548)||(36578027-36578085)
chr5 (487-548)||(4736486-4736547)
chr5 (490-547)||(18633597-18633654)
chr5 (486-547)||(29875670-29875731)
chr5 (491-548)||(30800493-30800550)
chr5 (491-548)||(30800794-30800851)
chr5 (490-547)||(35167110-35167167)
chr5 (490-547)||(35876686-35876743)
chr5 (492-588)||(36973614-36973710)
chr5 (491-540)||(40038493-40038542)
chr5 (492-588)||(40038762-40038858)
chr5 (487-548)||(42596448-42596509)
chr5 (490-542)||(10743722-10743774)
chr5 (490-542)||(16038375-16038427)
chr5 (491-547)||(19685016-19685072)
chr5 (495-547)||(20985728-20985780)
chr5 (490-542)||(28213371-28213423)
chr5 (492-548)||(28550827-28550883)
chr5 (492-548)||(28863782-28863838)
chr5 (492-548)||(29366893-29366949)
chr5 (494-546)||(35609583-35609635)
chr5 (492-548)||(40029441-40029497)
chr5 (491-542)||(2217804-2217855)
chr5 (487-542)||(13990845-13990900)
chr5 (491-542)||(18046298-18046349)
chr5 (491-542)||(20690732-20690783)
chr5 (489-547)||(15635652-15635710)
chr5 (489-547)||(18258159-18258217)
chr5 (490-548)||(26133357-26133415)
chr5 (493-547)||(29172524-29172578)
chr5 (487-541)||(35166906-35166960)
chr5 (490-548)||(38786157-38786215)
chr5 (490-548)||(40167784-40167842)
chr5 (492-588)||(1286682-1286778)
chr5 (490-547)||(10408926-10408983)
chr5 (491-548)||(10830528-10830585)
chr5 (491-548)||(11799402-11799459)
chr5 (491-548)||(23381949-23382006)
chr5 (491-540)||(25561951-25562000)
chr5 (491-548)||(25779106-25779163)
chr5 (487-548)||(26133178-26133239)
chr5 (495-548)||(28108106-28108159)
chr5 (491-548)||(36577721-36577778)
chr5 (490-547)||(37271651-37271708)
chr5 (490-542)||(293826-293878)
chr5 (492-540)||(6118451-6118499)
chr5 (486-542)||(10409276-10409332)
chr5 (492-540)||(18633913-18633961)
chr5 (490-542)||(27916714-27916766)
chr5 (492-548)||(33335970-33336026)
chr5 (486-542)||(34125301-34125357)
chr5 (492-548)||(35609303-35609359)
chr5 (491-542)||(38554750-38554799)
chr5 (489-548)||(18286685-18286744)
chr5 (492-547)||(25561705-25561760)
chr5 (489-548)||(34125576-34125635)
chr5 (491-542)||(39379560-39379611)
chr5 (490-548)||(1286989-1287047)
chr5 (492-542)||(2636669-2636719)
chr5 (490-540)||(9179872-9179922)
chr5 (491-584)||(12144906-12144998)
chr5 (490-548)||(18046036-18046094)
chr5 (486-548)||(20683741-20683803)
chr5 (492-542)||(23382247-23382297)
chr5 (491-537)||(31602142-31602188)
chr5 (489-547)||(38496727-38496785)
chr5 (492-542)||(42553642-42553692)
chr5 (491-548)||(4203714-4203771)
chr5 (491-548)||(10743998-10744055)
chr5 (490-547)||(11799127-11799184)
chr5 (491-548)||(24781988-24782045)
chr5 (76-193)||(26204180-26204297)
chr5 (491-540)||(31037693-31037742)
chr5 (496-580)||(32888691-32888775)
chr5 (492-580)||(36973353-36973441)
chr5 (487-540)||(40029136-40029189)
chr5 (495-548)||(42596761-42596814)
chr5 (491-547)||(3850544-3850600)
chr5 (492-548)||(5103945-5104001)
chr5 (490-542)||(5614164-5614216)
chr5 (490-542)||(9532485-9532537)
chr5 (486-542)||(14318039-14318095)
chr5 (494-542)||(16038690-16038738)
chr5 (492-548)||(21050857-21050913)
chr5 (490-542)||(29693040-29693092)
chr5 (486-542)||(36278075-36278131)
chr5 (492-544)||(38962806-38962858)
chr5 (495-547)||(39379242-39379294)
chr5 (492-539)||(3850299-3850346)
chr5 (492-547)||(29151516-29151571)
chr5 (491-542)||(38555034-38555084)
chr5 (492-542)||(2032890-2032940)
chr5 (492-542)||(15916286-15916336)
chr5 (490-532)||(17070533-17070575)
chr5 (488-538)||(20416356-20416406)
chr5 (494-540)||(38452348-38452394)
chr5 (492-546)||(42994068-42994122)
chr5 (495-540)||(45456-45501)
chr5 (491-548)||(9179592-9179649)
chr5 (494-539)||(12145136-12145181)
chr5 (486-547)||(15635370-15635431)
chr5 (491-548)||(26071290-26071347)
chr5 (495-548)||(28871640-28871693)
chr5 (491-540)||(32108807-32108856)
chr5 (491-548)||(40167952-40168009)
chr5 (491-548)||(42207241-42207298)
chr5 (494-542)||(16616370-16616418)
chr5 (494-542)||(20691046-20691094)
chr5 (491-547)||(35166103-35166159)
chr5 (490-538)||(38182041-38182089)
chr5 (490-538)||(38189042-38189090)
chr5 (490-538)||(38209267-38209315)
chr5 (490-538)||(38216267-38216315)
chr5 (488-548)||(42207517-42207576)
chr5 (493-548)||(29855614-29855669)
chr5 (487-542)||(31037390-31037445)
chr5 (766-811)||(2059124-2059167)
chr5 (493-542)||(9588561-9588611)
chr5 (491-541)||(17070814-17070864)
chr5 (505-539)||(28213446-28213480)
chr5 (491-548)||(3851273-3851330)
chr5 (491-536)||(4736204-4736249)
chr5 (505-542)||(31602221-31602258)
[»] chr4 (212 HSPs)
chr4 (592-811)||(6486478-6486701)
chr4 (490-588)||(13530617-13530715)
chr4 (490-588)||(24774043-24774141)
chr4 (486-588)||(25423918-25424020)
chr4 (490-588)||(43231293-43231391)
chr4 (485-588)||(23779129-23779232)
chr4 (490-588)||(29499180-29499278)
chr4 (490-588)||(30046696-30046794)
chr4 (490-588)||(30061037-30061135)
chr4 (486-588)||(35464012-35464114)
chr4 (491-588)||(13631227-13631324)
chr4 (491-588)||(14487801-14487898)
chr4 (491-588)||(23245499-23245596)
chr4 (491-588)||(53915951-53916048)
chr4 (492-588)||(46115414-46115510)
chr4 (492-588)||(46128548-46128644)
chr4 (490-580)||(2322344-2322434)
chr4 (490-548)||(45505838-45505896)
chr4 (490-547)||(31560329-31560386)
chr4 (492-588)||(31560599-31560695)
chr4 (487-548)||(31811920-31811981)
chr4 (491-548)||(32365093-32365150)
chr4 (488-588)||(50753918-50754018)
chr4 (493-588)||(2322094-2322189)
chr4 (486-542)||(18205150-18205206)
chr4 (491-547)||(26412189-26412245)
chr4 (492-548)||(41324834-41324890)
chr4 (490-542)||(44925483-44925535)
chr4 (494-588)||(19903559-19903653)
chr4 (492-547)||(23245231-23245286)
chr4 (490-580)||(25424224-25424314)
chr4 (492-547)||(35464327-35464382)
chr4 (490-588)||(42848025-42848123)
chr4 (492-547)||(42848336-42848391)
chr4 (489-548)||(52017502-52017561)
chr4 (489-548)||(52017814-52017873)
chr4 (489-548)||(54903419-54903478)
chr4 (486-548)||(2180214-2180276)
chr4 (490-548)||(5827917-5827975)
chr4 (490-548)||(13064409-13064467)
chr4 (491-588)||(13074029-13074126)
chr4 (489-547)||(13631544-13631602)
chr4 (490-548)||(16712635-16712693)
chr4 (490-544)||(23778962-23779016)
chr4 (490-548)||(26314276-26314334)
chr4 (489-547)||(29499491-29499549)
chr4 (488-542)||(32208538-32208592)
chr4 (488-542)||(32208851-32208905)
chr4 (491-588)||(42823775-42823872)
chr4 (486-547)||(6827819-6827880)
chr4 (490-547)||(14791751-14791808)
chr4 (492-588)||(35415537-35415633)
chr4 (490-547)||(41345851-41345908)
chr4 (490-547)||(43231086-43231143)
chr4 (487-548)||(45505595-45505656)
chr4 (491-539)||(4211560-4211608)
chr4 (492-548)||(13073759-13073815)
chr4 (491-547)||(35763646-35763702)
chr4 (487-539)||(46292387-46292439)
chr4 (489-588)||(47022737-47022836)
chr4 (491-547)||(47023050-47023106)
chr4 (493-580)||(51763114-51763201)
chr4 (492-588)||(53307973-53308068)
chr4 (492-548)||(53717118-53717174)
chr4 (491-547)||(53915682-53915738)
chr4 (493-548)||(6353582-6353637)
chr4 (492-582)||(19321769-19321859)
chr4 (491-542)||(20291985-20292036)
chr4 (487-542)||(22099538-22099593)
chr4 (492-547)||(26412529-26412584)
chr4 (491-542)||(29420487-29420538)
chr4 (497-587)||(47532577-47532667)
chr4 (490-588)||(51762868-51762966)
chr4 (490-548)||(2034799-2034857)
chr4 (490-540)||(8904884-8904934)
chr4 (486-548)||(13064153-13064215)
chr4 (491-580)||(14488099-14488188)
chr4 (494-548)||(18205467-18205521)
chr4 (488-542)||(22099862-22099916)
chr4 (490-548)||(29463857-29463915)
chr4 (490-548)||(31812157-31812215)
chr4 (490-548)||(32365427-32365485)
chr4 (490-548)||(35119290-35119348)
chr4 (490-548)||(36054094-36054152)
chr4 (486-548)||(36701994-36702056)
chr4 (490-548)||(38054544-38054602)
chr4 (486-548)||(45593530-45593592)
chr4 (491-588)||(51738136-51738233)
chr4 (490-548)||(55072387-55072445)
chr4 (489-542)||(6827543-6827596)
chr4 (491-548)||(11693065-11693122)
chr4 (491-548)||(12152437-12152494)
chr4 (491-548)||(12791918-12791975)
chr4 (491-548)||(13479555-13479612)
chr4 (489-542)||(51545626-51545679)
chr4 (495-548)||(51545913-51545966)
chr4 (487-540)||(52543417-52543470)
chr4 (491-547)||(123533-123589)
chr4 (490-542)||(5052534-5052586)
chr4 (492-548)||(5827655-5827711)
chr4 (488-548)||(8760600-8760660)
chr4 (323-380)||(9075166-9075225)
chr4 (491-547)||(9289265-9289321)
chr4 (491-547)||(13530378-13530434)
chr4 (492-548)||(13764613-13764669)
chr4 (495-547)||(15555506-15555558)
chr4 (494-542)||(16712331-16712379)
chr4 (490-542)||(24474913-24474965)
chr4 (492-548)||(26313988-26314044)
chr4 (492-548)||(27008084-27008140)
chr4 (484-540)||(28449166-28449222)
chr4 (490-542)||(28809130-28809182)
chr4 (490-542)||(29380860-29380912)
chr4 (495-547)||(30060772-30060824)
chr4 (490-542)||(34361801-34361853)
chr4 (495-547)||(41619902-41619954)
chr4 (491-547)||(46088005-46088061)
chr4 (490-542)||(46292601-46292653)
chr4 (490-542)||(51708977-51709029)
chr4 (490-542)||(54208775-54208827)
chr4 (497-548)||(2034544-2034595)
chr4 (489-548)||(9445946-9446005)
chr4 (493-548)||(11285504-11285559)
chr4 (495-542)||(14791502-14791549)
chr4 (489-540)||(20144683-20144734)
chr4 (492-547)||(29463610-29463665)
chr4 (490-588)||(31182409-31182506)
chr4 (493-548)||(36050289-36050344)
chr4 (493-548)||(37557139-37557194)
chr4 (493-548)||(44925789-44925844)
chr4 (492-547)||(50714240-50714295)
chr4 (492-547)||(50714510-50714565)
chr4 (491-542)||(51708692-51708743)
chr4 (490-588)||(54903109-54903207)
chr4 (490-548)||(8760725-8760783)
chr4 (490-548)||(18136057-18136115)
chr4 (495-541)||(20144423-20144469)
chr4 (489-547)||(27427869-27427926)
chr4 (491-588)||(35763859-35763956)
chr4 (489-547)||(41620201-41620259)
chr4 (488-542)||(45474546-45474600)
chr4 (490-548)||(49123265-49123323)
chr4 (490-548)||(52442036-52442094)
chr4 (491-548)||(5882551-5882607)
chr4 (129-214)||(9075000-9075085)
chr4 (491-548)||(12152153-12152210)
chr4 (489-542)||(13764757-13764810)
chr4 (485-542)||(14594199-14594256)
chr4 (491-548)||(19903260-19903317)
chr4 (490-547)||(46115724-46115781)
chr4 (490-547)||(46128858-46128915)
chr4 (493-542)||(47136121-47136170)
chr4 (491-548)||(52430044-52430101)
chr4 (491-548)||(52441762-52441819)
chr4 (495-540)||(55072664-55072709)
chr4 (495-542)||(5202929-5202977)
chr4 (492-548)||(8191335-8191391)
chr4 (491-547)||(9289584-9289640)
chr4 (491-547)||(19321569-19321625)
chr4 (491-547)||(35415298-35415354)
chr4 (494-588)||(35420606-35420701)
chr4 (492-548)||(43368721-43368777)
chr4 (491-539)||(51738364-51738412)
chr4 (511-590)||(54208480-54208559)
chr4 (492-548)||(55482412-55482468)
chr4 (491-542)||(11692761-11692812)
chr4 (493-540)||(13479273-13479320)
chr4 (491-542)||(22584286-22584337)
chr4 (492-547)||(25358485-25358540)
chr4 (497-548)||(27008350-27008401)
chr4 (491-542)||(28448833-28448884)
chr4 (494-588)||(30564835-30564929)
chr4 (491-538)||(35119565-35119612)
chr4 (493-548)||(36702307-36702362)
chr4 (491-542)||(41346168-41346219)
chr4 (487-542)||(41921034-41921089)
chr4 (491-542)||(53716920-53716971)
chr4 (492-542)||(4279285-4279335)
chr4 (494-548)||(35420393-35420447)
chr4 (161-243)||(41967707-41967789)
chr4 (492-542)||(42824041-42824091)
chr4 (494-548)||(43368467-43368521)
chr4 (497-542)||(123848-123893)
chr4 (491-548)||(4279021-4279078)
chr4 (495-548)||(5797484-5797537)
chr4 (495-540)||(5797772-5797817)
chr4 (493-542)||(15555588-15555637)
chr4 (491-548)||(22584551-22584608)
chr4 (490-539)||(29380666-29380715)
chr4 (491-548)||(34355227-34355284)
chr4 (491-548)||(45593227-45593284)
chr4 (492-540)||(8905186-8905234)
chr4 (492-548)||(28809011-28809067)
chr4 (129-213)||(29551790-29551874)
chr4 (491-543)||(31370803-31370855)
chr4 (493-540)||(7639897-7639944)
chr4 (491-542)||(24474599-24474649)
chr4 (492-542)||(2180522-2180572)
chr4 (490-524)||(9836830-9836864)
chr4 (494-548)||(18831122-18831176)
chr4 (489-523)||(33137256-33137290)
chr4 (505-539)||(36050359-36050393)
chr4 (492-542)||(47274180-47274230)
chr4 (494-540)||(52543679-52543725)
chr4 (492-542)||(55805038-55805088)
chr4 (486-523)||(3879080-3879117)
chr4 (493-538)||(25358213-25358258)
chr4 (493-542)||(30890832-30890881)
chr4 (491-524)||(33134890-33134923)
chr4 (491-548)||(37556840-37556897)
chr4 (429-470)||(41508423-41508464)
chr4 (491-548)||(50754200-50754257)
[»] chr8 (175 HSPs)
chr8 (490-588)||(10872913-10873011)
chr8 (487-548)||(4473988-4474049)
chr8 (488-588)||(28346390-28346490)
chr8 (489-588)||(7420494-7420593)
chr8 (490-588)||(8298879-8298977)
chr8 (486-588)||(10337113-10337215)
chr8 (490-588)||(37536084-37536182)
chr8 (491-588)||(4710124-4710221)
chr8 (491-588)||(6469279-6469376)
chr8 (491-588)||(9496340-9496437)
chr8 (492-588)||(34963568-34963664)
chr8 (490-585)||(11976371-11976465)
chr8 (490-588)||(32725905-32726003)
chr8 (491-588)||(3511905-3512002)
chr8 (492-588)||(7326324-7326421)
chr8 (490-548)||(14495067-14495125)
chr8 (486-548)||(24187563-24187625)
chr8 (489-547)||(34963297-34963355)
chr8 (491-588)||(35097327-35097424)
chr8 (491-588)||(35346902-35346999)
chr8 (491-548)||(25600229-25600286)
chr8 (492-548)||(10776443-10776499)
chr8 (491-547)||(11019802-11019858)
chr8 (488-548)||(14239024-14239084)
chr8 (493-588)||(24090392-24090487)
chr8 (491-547)||(28346703-28346759)
chr8 (491-547)||(32726216-32726272)
chr8 (490-588)||(2728230-2728328)
chr8 (492-547)||(2728542-2728597)
chr8 (484-547)||(9496668-9496731)
chr8 (489-548)||(10540726-10540785)
chr8 (488-547)||(11019516-11019575)
chr8 (489-548)||(16789072-16789131)
chr8 (490-580)||(20984144-20984234)
chr8 (490-588)||(20984414-20984512)
chr8 (490-588)||(27341495-27341593)
chr8 (492-547)||(35097637-35097692)
chr8 (492-582)||(42133064-42133154)
chr8 (488-542)||(2811731-2811785)
chr8 (491-588)||(5357422-5357519)
chr8 (491-580)||(13154885-13154974)
chr8 (495-588)||(13796500-13796593)
chr8 (486-548)||(16789313-16789375)
chr8 (490-548)||(20277690-20277748)
chr8 (491-588)||(20277961-20278058)
chr8 (490-548)||(21064317-21064375)
chr8 (491-588)||(21064588-21064685)
chr8 (489-547)||(22917561-22917619)
chr8 (490-548)||(25131109-25131167)
chr8 (490-548)||(40066495-40066553)
chr8 (490-548)||(43477161-43477219)
chr8 (490-539)||(3680754-3680803)
chr8 (490-547)||(7420228-7420285)
chr8 (492-580)||(8298587-8298675)
chr8 (490-582)||(44997929-44998021)
chr8 (490-542)||(1525807-1525859)
chr8 (491-547)||(3512211-3512267)
chr8 (492-548)||(4621298-4621354)
chr8 (492-548)||(7185948-7186004)
chr8 (491-547)||(7326085-7326141)
chr8 (491-547)||(10337394-10337450)
chr8 (492-544)||(13232510-13232562)
chr8 (492-548)||(14489017-14489073)
chr8 (487-547)||(16643989-16644049)
chr8 (491-547)||(19494118-19494174)
chr8 (491-547)||(19494358-19494414)
chr8 (490-542)||(32418316-32418368)
chr8 (492-547)||(1778564-1778619)
chr8 (492-586)||(7272657-7272751)
chr8 (490-588)||(9175010-9175108)
chr8 (492-547)||(10873225-10873280)
chr8 (494-588)||(13779151-13779245)
chr8 (486-588)||(25702506-25702608)
chr8 (492-547)||(35346629-35346684)
chr8 (492-547)||(37536364-37536419)
chr8 (491-588)||(13155155-13155252)
chr8 (490-548)||(14238749-14238807)
chr8 (491-580)||(24814980-24815069)
chr8 (484-542)||(24954960-24955018)
chr8 (487-588)||(28323844-28323944)
chr8 (495-588)||(28497523-28497616)
chr8 (490-548)||(29488054-29488112)
chr8 (489-547)||(38930299-38930357)
chr8 (490-547)||(4017245-4017302)
chr8 (495-548)||(13232201-13232254)
chr8 (491-548)||(17073806-17073863)
chr8 (491-548)||(17574407-17574464)
chr8 (491-548)||(27117752-27117809)
chr8 (490-539)||(27117929-27117978)
chr8 (491-548)||(29158353-29158410)
chr8 (491-548)||(29992244-29992301)
chr8 (491-548)||(33526356-33526413)
chr8 (495-587)||(33652193-33652285)
chr8 (491-547)||(1526117-1526173)
chr8 (490-542)||(1685112-1685164)
chr8 (492-540)||(4375692-4375740)
chr8 (491-547)||(4473703-4473759)
chr8 (486-542)||(6146510-6146566)
chr8 (490-542)||(7272418-7272470)
chr8 (495-547)||(11976681-11976733)
chr8 (493-541)||(13779483-13779531)
chr8 (490-542)||(14847823-14847875)
chr8 (491-547)||(16643660-16643716)
chr8 (488-548)||(28324125-28324185)
chr8 (490-542)||(28497253-28497305)
chr8 (490-542)||(31445413-31445465)
chr8 (491-547)||(35143789-35143845)
chr8 (492-548)||(40066764-40066820)
chr8 (492-548)||(40844156-40844212)
chr8 (492-540)||(42132864-42132912)
chr8 (490-585)||(42429756-42429850)
chr8 (497-548)||(3680532-3680583)
chr8 (493-540)||(4016906-4016953)
chr8 (493-548)||(6146893-6146948)
chr8 (491-542)||(8094791-8094842)
chr8 (495-542)||(9175321-9175368)
chr8 (491-542)||(10540448-10540499)
chr8 (491-542)||(18549200-18549251)
chr8 (491-542)||(33636321-33636372)
chr8 (489-540)||(38930616-38930667)
chr8 (488-542)||(1408303-1408357)
chr8 (488-542)||(2355883-2355937)
chr8 (494-548)||(18549517-18549571)
chr8 (490-540)||(21125717-21125767)
chr8 (490-548)||(22650462-22650520)
chr8 (492-546)||(23939547-23939601)
chr8 (492-542)||(25131397-25131447)
chr8 (490-548)||(25600541-25600599)
chr8 (492-542)||(29158619-29158669)
chr8 (492-542)||(42430070-42430120)
chr8 (492-542)||(44998213-44998263)
chr8 (493-542)||(5357713-5357762)
chr8 (489-542)||(14496813-14496866)
chr8 (490-547)||(24187842-24187899)
chr8 (497-542)||(24814710-24814755)
chr8 (491-540)||(35345569-35345618)
chr8 (491-548)||(40492959-40493016)
chr8 (491-547)||(8094478-8094534)
chr8 (492-540)||(10755480-10755528)
chr8 (490-542)||(14488714-14488766)
chr8 (493-588)||(15930933-15931028)
chr8 (490-542)||(23939860-23939912)
chr8 (490-542)||(29991913-29991965)
chr8 (486-538)||(30337171-30337223)
chr8 (492-547)||(1162909-1162964)
chr8 (488-542)||(14495340-14495394)
chr8 (491-542)||(28258191-28258242)
chr8 (493-540)||(36044744-36044791)
chr8 (494-540)||(10776150-10776196)
chr8 (492-542)||(15719656-15719706)
chr8 (490-548)||(26530666-26530724)
chr8 (492-542)||(33526052-33526102)
chr8 (490-548)||(40844479-40844537)
chr8 (494-548)||(43727097-43727151)
chr8 (491-548)||(28398979-28399036)
chr8 (492-537)||(40493112-40493157)
chr8 (492-548)||(1408005-1408061)
chr8 (492-528)||(30969681-30969717)
chr8 (491-539)||(35115592-35115640)
chr8 (495-542)||(2356198-2356245)
chr8 (491-542)||(4375961-4376011)
chr8 (491-542)||(27341257-27341308)
chr8 (493-548)||(30969399-30969454)
chr8 (492-542)||(1163224-1163274)
chr8 (492-534)||(9908918-9908960)
chr8 (491-533)||(25702768-25702810)
chr8 (492-542)||(29487750-29487800)
chr8 (486-548)||(32040069-32040131)
chr8 (558-588)||(32195345-32195375)
chr8 (491-548)||(6469611-6469668)
chr8 (493-542)||(7578478-7578527)
chr8 (491-548)||(19962994-19963051)
chr8 (491-548)||(21125965-21126022)
chr8 (490-523)||(22534750-22534783)
chr8 (518-547)||(24954697-24954726)
[»] chr7 (180 HSPs)
chr7 (490-588)||(1614808-1614906)
chr7 (490-588)||(9659593-9659691)
chr7 (489-588)||(45228822-45228921)
chr7 (486-588)||(5354762-5354864)
chr7 (490-588)||(44568594-44568692)
chr7 (491-588)||(29198566-29198663)
chr7 (490-582)||(3975547-3975639)
chr7 (492-584)||(16853497-16853589)
chr7 (488-588)||(46828940-46829040)
chr7 (489-588)||(41053839-41053938)
chr7 (490-588)||(5234108-5234206)
chr7 (490-588)||(8144293-8144391)
chr7 (8-235)||(18044338-18044565)
chr7 (490-588)||(25092452-25092550)
chr7 (486-588)||(27037587-27037689)
chr7 (489-587)||(30223700-30223798)
chr7 (486-588)||(35838241-35838343)
chr7 (490-588)||(48853974-48854072)
chr7 (490-587)||(23399881-23399978)
chr7 (491-588)||(25988384-25988481)
chr7 (491-588)||(48192392-48192489)
chr7 (491-548)||(22539929-22539986)
chr7 (486-547)||(23399606-23399667)
chr7 (490-547)||(25988694-25988751)
chr7 (491-587)||(28262712-28262808)
chr7 (492-588)||(35469880-35469976)
chr7 (491-547)||(8144603-8144659)
chr7 (491-547)||(23676397-23676453)
chr7 (491-547)||(26878016-26878072)
chr7 (491-542)||(3975788-3975839)
chr7 (489-548)||(13770025-13770084)
chr7 (490-580)||(27458397-27458487)
chr7 (490-588)||(34878029-34878127)
chr7 (486-580)||(41054148-41054242)
chr7 (490-548)||(12894346-12894404)
chr7 (490-548)||(19757746-19757804)
chr7 (489-547)||(26877675-26877733)
chr7 (490-548)||(28911850-28911908)
chr7 (491-580)||(35470192-35470281)
chr7 (490-548)||(37372848-37372906)
chr7 (490-547)||(5233806-5233863)
chr7 (490-547)||(6108332-6108389)
chr7 (491-548)||(17999665-17999722)
chr7 (490-547)||(25092158-25092215)
chr7 (495-544)||(25547256-25547305)
chr7 (491-548)||(35104239-35104296)
chr7 (491-548)||(35665876-35665933)
chr7 (489-542)||(35837921-35837974)
chr7 (490-547)||(44508999-44509056)
chr7 (495-548)||(44841359-44841412)
chr7 (490-547)||(48192255-48192312)
chr7 (491-547)||(1614558-1614614)
chr7 (492-544)||(19561154-19561206)
chr7 (489-588)||(39520634-39520733)
chr7 (486-589)||(44402954-44403057)
chr7 (486-542)||(46759652-46759708)
chr7 (492-548)||(46829256-46829312)
chr7 (490-542)||(48852442-48852494)
chr7 (492-547)||(1006835-1006890)
chr7 (492-539)||(6589021-6589068)
chr7 (490-588)||(8555703-8555801)
chr7 (486-588)||(11767179-11767281)
chr7 (491-586)||(12932690-12932784)
chr7 (491-542)||(38486740-38486791)
chr7 (491-542)||(39438740-39438791)
chr7 (492-547)||(44508720-44508775)
chr7 (490-548)||(2945789-2945847)
chr7 (491-588)||(3807863-3807960)
chr7 (490-548)||(6509206-6509264)
chr7 (490-548)||(6509414-6509472)
chr7 (492-542)||(7431951-7432001)
chr7 (490-548)||(16940760-16940818)
chr7 (491-588)||(28911576-28911673)
chr7 (491-588)||(35015124-35015221)
chr7 (486-548)||(35210176-35210238)
chr7 (490-548)||(44344733-44344791)
chr7 (489-547)||(44568323-44568381)
chr7 (491-588)||(45021760-45021857)
chr7 (490-548)||(45073585-45073643)
chr7 (493-592)||(6079810-6079906)
chr7 (495-548)||(16940996-16941049)
chr7 (491-548)||(20388273-20388330)
chr7 (490-547)||(30223459-30223516)
chr7 (490-547)||(39438974-39439031)
chr7 (491-548)||(39832905-39832962)
chr7 (490-542)||(6589224-6589276)
chr7 (494-542)||(6847069-6847117)
chr7 (491-547)||(9659354-9659410)
chr7 (492-548)||(10358312-10358368)
chr7 (495-539)||(11766920-11766964)
chr7 (490-542)||(14543708-14543760)
chr7 (492-548)||(17999465-17999521)
chr7 (492-548)||(19561394-19561450)
chr7 (490-542)||(21223698-21223750)
chr7 (495-547)||(23676135-23676187)
chr7 (491-547)||(29198302-29198358)
chr7 (492-548)||(35210459-35210515)
chr7 (492-548)||(39833180-39833236)
chr7 (492-548)||(46759886-46759942)
chr7 (492-544)||(48359023-48359075)
chr7 (501-548)||(1271543-1271590)
chr7 (495-542)||(5355067-5355114)
chr7 (491-542)||(18022654-18022705)
chr7 (491-542)||(23816669-23816720)
chr7 (490-588)||(31503418-31503516)
chr7 (490-541)||(38186364-38186415)
chr7 (486-588)||(45073308-45073410)
chr7 (490-548)||(1559649-1559707)
chr7 (492-542)||(13769774-13769824)
chr7 (488-538)||(31310633-31310683)
chr7 (494-548)||(32189334-32189388)
chr7 (491-588)||(38486477-38486574)
chr7 (490-548)||(39520396-39520454)
chr7 (490-548)||(44958450-44958508)
chr7 (486-547)||(45021488-45021550)
chr7 (490-540)||(46648667-46648717)
chr7 (488-588)||(1559339-1559439)
chr7 (491-548)||(10358000-10358057)
chr7 (490-547)||(14738949-14739006)
chr7 (493-546)||(18022368-18022421)
chr7 (487-548)||(20388619-20388680)
chr7 (491-548)||(21554697-21554754)
chr7 (490-547)||(30352558-30352615)
chr7 (490-547)||(35104076-35104133)
chr7 (486-542)||(38186710-38186767)
chr7 (491-548)||(39719586-39719643)
chr7 (492-548)||(1974009-1974065)
chr7 (492-540)||(6911199-6911247)
chr7 (486-542)||(21223399-21223455)
chr7 (492-548)||(25547434-25547490)
chr7 (492-540)||(31732101-31732149)
chr7 (496-548)||(37372441-37372493)
chr7 (492-548)||(41364884-41364940)
chr7 (491-547)||(45228614-45228670)
chr7 (490-542)||(46304084-46304136)
chr7 (495-542)||(7432202-7432249)
chr7 (491-542)||(19783814-19783865)
chr7 (491-542)||(20355407-20355458)
chr7 (492-547)||(30352849-30352904)
chr7 (491-542)||(30709594-30709645)
chr7 (490-541)||(31732402-31732453)
chr7 (495-542)||(34877777-34877824)
chr7 (493-548)||(37527366-37527421)
chr7 (493-548)||(41365158-41365213)
chr7 (492-542)||(1007179-1007229)
chr7 (490-548)||(5308631-5308688)
chr7 (496-542)||(6954862-6954908)
chr7 (494-548)||(17854151-17854205)
chr7 (492-542)||(21554393-21554443)
chr7 (490-548)||(23816978-23817036)
chr7 (492-542)||(24717482-24717532)
chr7 (494-548)||(28263015-28263069)
chr7 (488-542)||(30709321-30709375)
chr7 (490-540)||(36684533-36684583)
chr7 (492-542)||(39719353-39719403)
chr7 (492-542)||(44403199-44403249)
chr7 (491-548)||(6892204-6892261)
chr7 (491-548)||(19465925-19465981)
chr7 (493-542)||(43300613-43300662)
chr7 (495-548)||(45671217-45671270)
chr7 (492-548)||(5308323-5308379)
chr7 (492-548)||(28528905-28528961)
chr7 (495-539)||(28529162-28529206)
chr7 (492-540)||(32189076-32189124)
chr7 (486-542)||(37953001-37953057)
chr7 (505-580)||(41054088-41054163)
chr7 (492-548)||(46304328-46304384)
chr7 (493-540)||(18311581-18311628)
chr7 (492-543)||(19005598-19005649)
chr7 (491-542)||(31310364-31310415)
chr7 (495-542)||(31503733-31503780)
chr7 (490-548)||(489016-489074)
chr7 (558-588)||(6911149-6911179)
chr7 (518-548)||(22540235-22540265)
chr7 (486-544)||(24954098-24954156)
chr7 (490-524)||(41693643-41693677)
chr7 (495-533)||(44841673-44841711)
chr7 (505-542)||(3808069-3808106)
chr7 (511-540)||(12894060-12894089)
chr7 (511-548)||(19758003-19758040)
[»] chr6 (142 HSPs)
chr6 (490-588)||(12299044-12299142)
chr6 (491-585)||(3968916-3969010)
chr6 (491-588)||(3414386-3414483)
chr6 (491-588)||(20467622-20467719)
chr6 (491-588)||(21993786-21993883)
chr6 (491-588)||(22543353-22543450)
chr6 (490-588)||(21385488-21385586)
chr6 (491-588)||(6412217-6412314)
chr6 (491-588)||(25137261-25137358)
chr6 (491-548)||(1007453-1007510)
chr6 (491-548)||(19321075-19321132)
chr6 (491-547)||(12419883-12419939)
chr6 (490-588)||(17765007-17765106)
chr6 (491-547)||(21994348-21994404)
chr6 (491-547)||(32885672-32885728)
chr6 (486-580)||(1007118-1007212)
chr6 (488-547)||(6412524-6412583)
chr6 (491-542)||(12419707-12419758)
chr6 (489-587)||(12757607-12757705)
chr6 (486-588)||(23502444-23502546)
chr6 (488-547)||(24274076-24274135)
chr6 (491-580)||(10910876-10910965)
chr6 (488-542)||(13268105-13268159)
chr6 (490-548)||(19690391-19690449)
chr6 (490-548)||(25136992-25137050)
chr6 (487-588)||(34582524-34582625)
chr6 (489-542)||(3276304-3276357)
chr6 (490-547)||(3968643-3968700)
chr6 (490-547)||(15076149-15076206)
chr6 (491-548)||(21147403-21147460)
chr6 (490-547)||(21385249-21385306)
chr6 (490-539)||(23502235-23502284)
chr6 (490-547)||(24273826-24273883)
chr6 (490-547)||(33801688-33801745)
chr6 (491-543)||(777991-778043)
chr6 (491-547)||(7156105-7156161)
chr6 (492-548)||(15962333-15962389)
chr6 (491-547)||(22543663-22543719)
chr6 (493-588)||(30479326-30479421)
chr6 (491-542)||(1214946-1214997)
chr6 (491-542)||(8170101-8170152)
chr6 (494-580)||(13617531-13617617)
chr6 (489-548)||(14656204-14656263)
chr6 (492-547)||(31198615-31198670)
chr6 (492-542)||(494405-494455)
chr6 (491-588)||(18024279-18024376)
chr6 (487-588)||(19267560-19267661)
chr6 (490-548)||(21995062-21995120)
chr6 (492-542)||(24901239-24901289)
chr6 (490-540)||(26375691-26375741)
chr6 (490-548)||(30928679-30928737)
chr6 (493-547)||(31166871-31166925)
chr6 (486-548)||(34990259-34990321)
chr6 (491-548)||(318041-318098)
chr6 (490-547)||(3414697-3414754)
chr6 (490-547)||(7155795-7155852)
chr6 (490-547)||(8681061-8681118)
chr6 (490-547)||(20467349-20467406)
chr6 (490-547)||(22822596-22822653)
chr6 (491-548)||(25431798-25431855)
chr6 (495-548)||(26375989-26376042)
chr6 (491-548)||(34582836-34582893)
chr6 (491-547)||(1890397-1890453)
chr6 (490-542)||(3356140-3356192)
chr6 (491-547)||(8680774-8680830)
chr6 (491-547)||(14655378-14655434)
chr6 (491-547)||(15962026-15962082)
chr6 (491-547)||(19129335-19129391)
chr6 (492-540)||(19296359-19296407)
chr6 (490-542)||(22792849-22792901)
chr6 (492-548)||(30928988-30929044)
chr6 (496-547)||(543365-543416)
chr6 (491-542)||(2615871-2615922)
chr6 (495-542)||(3356448-3356495)
chr6 (495-585)||(7324099-7324189)
chr6 (490-588)||(13150654-13150752)
chr6 (493-548)||(14428651-14428706)
chr6 (493-548)||(23770162-23770217)
chr6 (490-548)||(2373177-2373235)
chr6 (490-548)||(6468308-6468366)
chr6 (488-542)||(11448533-11448587)
chr6 (490-548)||(11449113-11449171)
chr6 (495-588)||(12176547-12176640)
chr6 (486-548)||(12612303-12612365)
chr6 (492-542)||(15442937-15442987)
chr6 (492-542)||(17771911-17771961)
chr6 (491-580)||(19129432-19129521)
chr6 (490-548)||(33131794-33131852)
chr6 (490-539)||(2616193-2616242)
chr6 (494-547)||(5286896-5286949)
chr6 (490-539)||(6591113-6591162)
chr6 (491-587)||(15722805-15722901)
chr6 (495-548)||(18024014-18024067)
chr6 (491-548)||(25121440-25121497)
chr6 (490-542)||(9896587-9896639)
chr6 (492-548)||(10910629-10910685)
chr6 (492-544)||(11129491-11129543)
chr6 (504-548)||(13617760-13617804)
chr6 (492-548)||(21995369-21995425)
chr6 (490-542)||(22822305-22822357)
chr6 (491-547)||(24692924-24692980)
chr6 (492-548)||(31186535-31186591)
chr6 (491-547)||(33808619-33808675)
chr6 (486-541)||(317806-317861)
chr6 (493-540)||(494704-494751)
chr6 (491-542)||(6564894-6564944)
chr6 (495-542)||(12298825-12298872)
chr6 (490-580)||(17765287-17765377)
chr6 (491-542)||(25121183-25121233)
chr6 (489-548)||(25431573-25431632)
chr6 (492-547)||(31167145-31167200)
chr6 (494-548)||(9896280-9896334)
chr6 (486-548)||(14655897-14655959)
chr6 (490-548)||(19296106-19296164)
chr6 (494-540)||(19320769-19320815)
chr6 (491-533)||(23770398-23770440)
chr6 (490-547)||(777675-777732)
chr6 (489-542)||(1214693-1214746)
chr6 (491-548)||(1875501-1875558)
chr6 (490-547)||(1890057-1890114)
chr6 (494-543)||(6591391-6591440)
chr6 (495-548)||(10091039-10091092)
chr6 (491-544)||(11925981-11926034)
chr6 (489-542)||(14428900-14428953)
chr6 (491-548)||(15722609-15722666)
chr6 (493-542)||(23628799-23628848)
chr6 (493-542)||(34989962-34990011)
chr6 (491-542)||(6564580-6564632)
chr6 (486-545)||(15116667-15116724)
chr6 (486-542)||(30239287-30239343)
chr6 (490-542)||(31398491-31398543)
chr6 (489-528)||(15117004-15117043)
chr6 (493-548)||(31276284-31276339)
chr6 (492-542)||(11925739-11925789)
chr6 (490-548)||(19267856-19267914)
chr6 (496-534)||(19690717-19690755)
chr6 (491-537)||(30479062-30479108)
chr6 (491-540)||(543676-543725)
chr6 (490-548)||(7323862-7323924)
chr6 (492-545)||(12611995-12612048)
chr6 (505-542)||(19275186-19275223)
chr6 (491-548)||(24901498-24901555)
[»] chr3 (227 HSPs)
chr3 (490-588)||(43441507-43441605)
chr3 (490-585)||(31480134-31480229)
chr3 (490-588)||(19844485-19844583)
chr3 (486-588)||(51550350-51550452)
chr3 (491-588)||(28552020-28552117)
chr3 (491-588)||(47336485-47336582)
chr3 (492-585)||(49323782-49323875)
chr3 (491-588)||(54608767-54608864)
chr3 (492-588)||(9261789-9261885)
chr3 (490-585)||(12741178-12741273)
chr3 (491-547)||(45002020-45002076)
chr3 (490-585)||(45002292-45002387)
chr3 (491-542)||(9603628-9603679)
chr3 (486-588)||(21159721-21159823)
chr3 (490-580)||(35565506-35565596)
chr3 (486-588)||(47005423-47005525)
chr3 (490-548)||(25615973-25616031)
chr3 (488-542)||(46751267-46751321)
chr3 (487-548)||(4513258-4513319)
chr3 (488-580)||(9597007-9597099)
chr3 (486-547)||(20612843-20612904)
chr3 (487-587)||(22008521-22008621)
chr3 (487-587)||(22016039-22016139)
chr3 (492-588)||(26089982-26090078)
chr3 (490-547)||(54608516-54608573)
chr3 (489-588)||(474041-474140)
chr3 (491-547)||(474353-474409)
chr3 (492-548)||(4034997-4035053)
chr3 (490-585)||(8940158-8940253)
chr3 (486-542)||(14772205-14772261)
chr3 (491-547)||(28552328-28552384)
chr3 (489-588)||(35569040-35569139)
chr3 (491-547)||(39288843-39288899)
chr3 (487-590)||(45313765-45313868)
chr3 (487-547)||(47336223-47336283)
chr3 (491-547)||(51550081-51550137)
chr3 (490-588)||(1721356-1721454)
chr3 (488-547)||(3387261-3387320)
chr3 (491-542)||(9262105-9262156)
chr3 (492-547)||(22008835-22008890)
chr3 (492-547)||(43441270-43441325)
chr3 (489-548)||(48924184-48924243)
chr3 (490-548)||(4950035-4950093)
chr3 (492-542)||(40370539-40370589)
chr3 (489-547)||(51834605-51834663)
chr3 (492-580)||(4034717-4034805)
chr3 (487-548)||(4513564-4513625)
chr3 (490-547)||(8940470-8940527)
chr3 (490-547)||(10977286-10977343)
chr3 (486-547)||(12740901-12740962)
chr3 (491-588)||(15979606-15979702)
chr3 (490-547)||(28427553-28427610)
chr3 (491-548)||(29955610-29955667)
chr3 (491-548)||(30004765-30004822)
chr3 (491-548)||(30106164-30106221)
chr3 (491-548)||(30128283-30128340)
chr3 (491-548)||(30130157-30130214)
chr3 (490-547)||(32119529-32119586)
chr3 (490-547)||(37507167-37507224)
chr3 (490-547)||(39437054-39437111)
chr3 (492-584)||(40370285-40370377)
chr3 (492-588)||(44802282-44802377)
chr3 (491-547)||(3152056-3152112)
chr3 (490-542)||(3387554-3387606)
chr3 (585-649)||(14743795-14743859)
chr3 (489-541)||(21553886-21553938)
chr3 (492-548)||(25710814-25710870)
chr3 (485-588)||(35936773-35936876)
chr3 (491-547)||(37506866-37506922)
chr3 (488-548)||(45320923-45320983)
chr3 (491-542)||(3151749-3151800)
chr3 (491-542)||(3830466-3830517)
chr3 (492-547)||(10976978-10977033)
chr3 (493-548)||(11463233-11463288)
chr3 (491-542)||(15286155-15286206)
chr3 (492-547)||(15979338-15979393)
chr3 (492-547)||(26089730-26089785)
chr3 (491-542)||(29490693-29490744)
chr3 (492-547)||(31480445-31480500)
chr3 (487-542)||(39288568-39288623)
chr3 (494-588)||(45006153-45006247)
chr3 (490-580)||(47005152-47005242)
chr3 (313-475)||(4159791-4159953)
chr3 (490-548)||(5345633-5345691)
chr3 (493-547)||(22156238-22156292)
chr3 (488-542)||(25610080-25610134)
chr3 (491-588)||(27681586-27681683)
chr3 (491-588)||(28452146-28452243)
chr3 (489-547)||(28942850-28942908)
chr3 (490-548)||(30268503-30268561)
chr3 (491-588)||(32119219-32119316)
chr3 (490-548)||(35177253-35177311)
chr3 (485-547)||(39436711-39436773)
chr3 (486-548)||(40545558-40545620)
chr3 (490-540)||(40979662-40979712)
chr3 (494-587)||(46724545-46724638)
chr3 (494-548)||(50196301-50196355)
chr3 (488-542)||(52342533-52342587)
chr3 (491-548)||(3830133-3830190)
chr3 (488-588)||(4322093-4322193)
chr3 (491-540)||(9603871-9603920)
chr3 (490-547)||(13584312-13584369)
chr3 (489-542)||(20611017-20611070)
chr3 (490-547)||(26799886-26799943)
chr3 (491-548)||(30034416-30034473)
chr3 (491-548)||(35407734-35407791)
chr3 (490-547)||(40169342-40169399)
chr3 (491-540)||(52342194-52342243)
chr3 (486-542)||(3361768-3361824)
chr3 (492-548)||(7957170-7957226)
chr3 (492-548)||(9863348-9863404)
chr3 (492-548)||(15016388-15016444)
chr3 (492-548)||(16123139-16123195)
chr3 (491-547)||(28452321-28452377)
chr3 (491-543)||(28942524-28942576)
chr3 (492-548)||(29445954-29446010)
chr3 (486-542)||(29525099-29525155)
chr3 (495-547)||(45005889-45005941)
chr3 (490-542)||(46186721-46186773)
chr3 (490-542)||(47114485-47114537)
chr3 (491-547)||(51500630-51500686)
chr3 (491-547)||(51834887-51834943)
chr3 (492-548)||(53701607-53701663)
chr3 (489-540)||(2486854-2486905)
chr3 (489-540)||(4814537-4814588)
chr3 (491-542)||(7588317-7588368)
chr3 (492-547)||(8510214-8510269)
chr3 (490-588)||(12673642-12673740)
chr3 (494-541)||(14633547-14633594)
chr3 (495-542)||(20907407-20907454)
chr3 (494-588)||(30034109-30034203)
chr3 (491-542)||(34238597-34238648)
chr3 (491-588)||(863280-863377)
chr3 (494-587)||(2486581-2486674)
chr3 (494-544)||(7518394-7518444)
chr3 (490-548)||(29678022-29678080)
chr3 (492-542)||(29686820-29686870)
chr3 (494-548)||(29955300-29955354)
chr3 (494-548)||(30004454-30004508)
chr3 (494-548)||(31869596-31869650)
chr3 (488-542)||(38232237-38232291)
chr3 (490-540)||(40277820-40277870)
chr3 (490-536)||(44802504-44802550)
chr3 (491-548)||(20404889-20404946)
chr3 (486-547)||(22155923-22155984)
chr3 (491-588)||(25609766-25609862)
chr3 (488-580)||(29686540-29686632)
chr3 (491-548)||(31869900-31869957)
chr3 (488-545)||(36673192-36673249)
chr3 (491-548)||(50196601-50196658)
chr3 (490-539)||(53113441-53113490)
chr3 (491-547)||(275443-275499)
chr3 (486-542)||(4814849-4814904)
chr3 (490-542)||(7518088-7518140)
chr3 (490-542)||(19656539-19656591)
chr3 (492-548)||(19844265-19844321)
chr3 (486-542)||(20757725-20757781)
chr3 (490-542)||(21159451-21159503)
chr3 (491-547)||(28427244-28427300)
chr3 (490-542)||(34238865-34238917)
chr3 (491-547)||(46622074-46622130)
chr3 (495-547)||(49324091-49324143)
chr3 (493-541)||(51760069-51760117)
chr3 (490-580)||(863564-863654)
chr3 (495-542)||(8555258-8555305)
chr3 (493-548)||(9596759-9596814)
chr3 (491-542)||(13514527-13514578)
chr3 (495-542)||(20757403-20757450)
chr3 (491-542)||(29446156-29446207)
chr3 (492-547)||(40169599-40169654)
chr3 (490-588)||(51759817-51759915)
chr3 (486-548)||(1721083-1721145)
chr3 (313-475)||(4143979-4144141)
chr3 (490-548)||(10778368-10778426)
chr3 (490-548)||(20644820-20644878)
chr3 (492-545)||(275780-275833)
chr3 (491-540)||(4321945-4321994)
chr3 (493-542)||(11463431-11463480)
chr3 (490-547)||(14633834-14633891)
chr3 (491-548)||(20405167-20405224)
chr3 (491-548)||(25710509-25710566)
chr3 (492-541)||(29678338-29678387)
chr3 (489-542)||(30130454-30130507)
chr3 (490-547)||(30552423-30552480)
chr3 (495-548)||(40545783-40545836)
chr3 (487-548)||(45521780-45521841)
chr3 (493-542)||(46186410-46186459)
chr3 (491-548)||(46901103-46901160)
chr3 (492-588)||(50009189-50009284)
chr3 (493-534)||(53113716-53113757)
chr3 (488-548)||(12673925-12673985)
chr3 (492-548)||(20644505-20644561)
chr3 (496-548)||(21970994-21971046)
chr3 (496-548)||(21993430-21993482)
chr3 (490-534)||(25353197-25353241)
chr3 (488-544)||(27200434-27200490)
chr3 (489-541)||(35533276-35533328)
chr3 (488-548)||(36732636-36732696)
chr3 (492-540)||(39072165-39072213)
chr3 (490-542)||(43440493-43440545)
chr3 (494-542)||(43440737-43440785)
chr3 (486-542)||(45161107-45161163)
chr3 (492-547)||(49670747-49670803)
chr3 (501-580)||(52956612-52956691)
chr3 (492-548)||(53701361-53701417)
chr3 (495-542)||(9863050-9863096)
chr3 (513-544)||(16123450-16123481)
chr3 (487-530)||(26273786-26273829)
chr3 (493-548)||(28418844-28418899)
chr3 (488-547)||(34582520-34582579)
chr3 (495-542)||(36672966-36673013)
chr3 (493-548)||(46724846-46724901)
chr3 (491-542)||(51500397-51500448)
chr3 (505-539)||(20644578-20644612)
chr3 (492-542)||(30424628-30424678)
chr3 (492-542)||(30426177-30426226)
chr3 (486-524)||(39132874-39132912)
chr3 (494-540)||(46621778-46621824)
chr3 (513-542)||(590197-590226)
chr3 (498-547)||(8510474-8510523)
chr3 (486-523)||(20585672-20585709)
chr3 (502-539)||(25610024-25610061)
chr3 (495-540)||(35177518-35177563)
chr3 (505-542)||(35565581-35565618)
chr3 (490-543)||(40279284-40279337)
chr3 (491-548)||(47114747-47114804)
chr3 (495-548)||(54767471-54767524)
[»] chr1 (200 HSPs)
chr1 (490-588)||(24507747-24507845)
chr1 (489-588)||(12360872-12360971)
chr1 (490-588)||(3247196-3247294)
chr1 (490-588)||(19720710-19720808)
chr1 (490-588)||(38164199-38164297)
chr1 (490-588)||(47819500-47819598)
chr1 (491-588)||(8140433-8140530)
chr1 (492-585)||(38151119-38151212)
chr1 (492-588)||(24653802-24653898)
chr1 (493-588)||(44157696-44157791)
chr1 (486-584)||(8140707-8140805)
chr1 (492-590)||(10631164-10631262)
chr1 (490-588)||(15526266-15526364)
chr1 (492-547)||(24507479-24507534)
chr1 (490-588)||(30322927-30323025)
chr1 (491-588)||(10887502-10887599)
chr1 (489-547)||(19622962-19623020)
chr1 (492-585)||(33000305-33000398)
chr1 (490-548)||(33045634-33045692)
chr1 (490-548)||(35307713-35307771)
chr1 (491-588)||(45638798-45638895)
chr1 (492-588)||(35056530-35056626)
chr1 (492-588)||(40718110-40718206)
chr1 (492-588)||(45380540-45380636)
chr1 (489-588)||(29072494-29072593)
chr1 (490-542)||(29688378-29688430)
chr1 (491-547)||(47819231-47819287)
chr1 (490-542)||(52254181-52254233)
chr1 (490-588)||(24978026-24978124)
chr1 (490-548)||(1810925-1810983)
chr1 (490-587)||(8364614-8364711)
chr1 (490-544)||(15058714-15058768)
chr1 (490-587)||(15211509-15211606)
chr1 (494-548)||(17129691-17129745)
chr1 (486-548)||(18302331-18302393)
chr1 (486-548)||(18899833-18899895)
chr1 (491-588)||(26324584-26324681)
chr1 (489-547)||(31061096-31061154)
chr1 (490-548)||(32626527-32626585)
chr1 (489-547)||(32728994-32729052)
chr1 (490-548)||(33234544-33234602)
chr1 (491-588)||(39747739-39747836)
chr1 (490-548)||(45368488-45368546)
chr1 (486-547)||(3247507-3247568)
chr1 (490-547)||(10631473-10631530)
chr1 (491-548)||(13770488-13770545)
chr1 (491-548)||(22919683-22919740)
chr1 (490-547)||(26061954-26062011)
chr1 (492-588)||(31060787-31060883)
chr1 (490-547)||(33000614-33000671)
chr1 (490-547)||(38163929-38163986)
chr1 (491-547)||(990324-990380)
chr1 (490-542)||(11822002-11822054)
chr1 (491-547)||(15516581-15516637)
chr1 (491-547)||(16026883-16026939)
chr1 (492-548)||(16060829-16060885)
chr1 (491-547)||(18473271-18473327)
chr1 (490-542)||(18473545-18473597)
chr1 (491-547)||(30323238-30323294)
chr1 (490-542)||(33379886-33379938)
chr1 (486-542)||(35005694-35005750)
chr1 (491-547)||(35056839-35056895)
chr1 (492-548)||(35308055-35308111)
chr1 (491-547)||(41358368-41358424)
chr1 (491-547)||(41358608-41358664)
chr1 (491-547)||(45380271-45380327)
chr1 (497-548)||(2939934-2939985)
chr1 (493-548)||(3753214-3753269)
chr1 (490-588)||(5058896-5058994)
chr1 (492-547)||(7001842-7001897)
chr1 (491-542)||(7819053-7819104)
chr1 (489-548)||(12361008-12361067)
chr1 (486-588)||(18928046-18928148)
chr1 (490-541)||(24654118-24654169)
chr1 (492-547)||(24977778-24977833)
chr1 (488-547)||(31258335-31258394)
chr1 (492-547)||(38136926-38136981)
chr1 (492-547)||(45638580-45638635)
chr1 (492-547)||(46868522-46868577)
chr1 (489-547)||(990085-990143)
chr1 (490-548)||(3679624-3679682)
chr1 (490-548)||(3753516-3753574)
chr1 (494-548)||(4789310-4789364)
chr1 (490-548)||(6567440-6567498)
chr1 (492-585)||(12322877-12322970)
chr1 (495-588)||(15335199-15335292)
chr1 (490-548)||(26442843-26442901)
chr1 (486-544)||(42483219-42483277)
chr1 (486-547)||(10887227-10887288)
chr1 (491-548)||(14007488-14007545)
chr1 (493-542)||(15058419-15058468)
chr1 (491-548)||(21391095-21391152)
chr1 (492-541)||(24649350-24649399)
chr1 (491-548)||(32454238-32454295)
chr1 (491-548)||(33045354-33045411)
chr1 (492-588)||(33234816-33234912)
chr1 (490-547)||(35005442-35005499)
chr1 (486-547)||(37545622-37545683)
chr1 (490-547)||(38150846-38150903)
chr1 (493-542)||(44641079-44641128)
chr1 (487-548)||(44641376-44641437)
chr1 (490-547)||(45290455-45290512)
chr1 (492-588)||(48955970-48956066)
chr1 (491-548)||(50429153-50429210)
chr1 (491-548)||(50799129-50799186)
chr1 (491-547)||(13260266-13260322)
chr1 (490-542)||(16060594-16060645)
chr1 (490-542)||(17984331-17984383)
chr1 (486-542)||(19622649-19622705)
chr1 (495-547)||(19721019-19721071)
chr1 (492-548)||(22953500-22953556)
chr1 (492-548)||(29072806-29072862)
chr1 (492-548)||(41738796-41738852)
chr1 (491-589)||(42482978-42483077)
chr1 (490-542)||(44157992-44158044)
chr1 (491-547)||(45290765-45290821)
chr1 (494-542)||(46183686-46183734)
chr1 (492-548)||(52254423-52254479)
chr1 (493-548)||(7818783-7818838)
chr1 (493-548)||(19198893-19198948)
chr1 (488-547)||(41881089-41881148)
chr1 (491-542)||(48609544-48609595)
chr1 (491-542)||(48955713-48955764)
chr1 (490-548)||(7867301-7867359)
chr1 (492-542)||(12322604-12322654)
chr1 (491-541)||(12360602-12360652)
chr1 (492-538)||(15211812-15211858)
chr1 (494-540)||(17130035-17130081)
chr1 (492-542)||(17984651-17984701)
chr1 (490-548)||(18079396-18079454)
chr1 (494-548)||(25658245-25658299)
chr1 (492-542)||(26191359-26191409)
chr1 (492-542)||(26191684-26191734)
chr1 (494-548)||(26207280-26207334)
chr1 (492-542)||(26442563-26442613)
chr1 (491-588)||(28507362-28507459)
chr1 (493-547)||(32420099-32420153)
chr1 (490-548)||(34002884-34002942)
chr1 (489-539)||(37624743-37624793)
chr1 (492-542)||(39025332-39025381)
chr1 (491-586)||(41739029-41739121)
chr1 (490-548)||(48609234-48609292)
chr1 (490-540)||(49073689-49073739)
chr1 (493-542)||(4323829-4323878)
chr1 (491-548)||(11822309-11822366)
chr1 (491-548)||(13259987-13260044)
chr1 (495-548)||(18900077-18900130)
chr1 (491-548)||(24649604-24649661)
chr1 (492-548)||(3679930-3679986)
chr1 (486-542)||(7350417-7350473)
chr1 (129-331)||(15500090-15500289)
chr1 (490-542)||(16026571-16026623)
chr1 (490-534)||(18079618-18079662)
chr1 (492-548)||(20948755-20948811)
chr1 (492-540)||(25658014-25658062)
chr1 (495-547)||(31258647-31258699)
chr1 (498-542)||(32035442-32035486)
chr1 (494-542)||(48730567-48730615)
chr1 (495-542)||(7350686-7350733)
chr1 (486-588)||(7867123-7867225)
chr1 (492-547)||(12158690-12158745)
chr1 (491-542)||(22674202-22674253)
chr1 (491-542)||(22919927-22919978)
chr1 (491-542)||(26324897-26324948)
chr1 (493-548)||(27521577-27521632)
chr1 (491-534)||(36912852-36912895)
chr1 (493-548)||(39303675-39303730)
chr1 (488-547)||(39747470-39747528)
chr1 (492-547)||(40718419-40718474)
chr1 (492-542)||(24510258-24510308)
chr1 (489-539)||(39025106-39025156)
chr1 (494-548)||(45368793-45368847)
chr1 (491-548)||(4565280-4565337)
chr1 (491-540)||(15334916-15334965)
chr1 (489-542)||(16083044-16083097)
chr1 (491-548)||(21383103-21383160)
chr1 (491-548)||(21383372-21383429)
chr1 (490-547)||(26062203-26062260)
chr1 (493-534)||(26142630-26142671)
chr1 (490-539)||(34002633-34002682)
chr1 (495-548)||(34808200-34808253)
chr1 (491-548)||(49923762-49923819)
chr1 (489-541)||(4360577-4360629)
chr1 (491-539)||(8364869-8364917)
chr1 (490-542)||(21391324-21391376)
chr1 (491-539)||(33067347-33067395)
chr1 (103-226)||(11896310-11896432)
chr1 (491-542)||(26142419-26142470)
chr1 (491-542)||(26699557-26699607)
chr1 (493-548)||(33067674-33067729)
chr1 (492-542)||(33380206-33380257)
chr1 (505-539)||(7350629-7350663)
chr1 (488-542)||(20756015-20756069)
chr1 (505-539)||(28507188-28507222)
chr1 (491-533)||(32035747-32035789)
chr1 (491-588)||(50428872-50428969)
chr1 (501-542)||(292868-292909)
chr1 (497-542)||(16083349-16083394)
chr1 (511-548)||(18302072-18302109)
chr1 (493-542)||(34382948-34382996)
[»] scaffold0026 (2 HSPs)
scaffold0026 (491-588)||(82610-82707)
scaffold0026 (486-547)||(82335-82396)
[»] scaffold0024 (2 HSPs)
scaffold0024 (491-588)||(75358-75455)
scaffold0024 (491-547)||(75709-75765)
[»] scaffold0160 (2 HSPs)
scaffold0160 (491-588)||(27268-27365)
scaffold0160 (505-539)||(27072-27106)
[»] scaffold0003 (2 HSPs)
scaffold0003 (487-548)||(366217-366278)
scaffold0003 (492-548)||(365979-366035)
[»] scaffold0056 (3 HSPs)
scaffold0056 (490-585)||(54813-54908)
scaffold0056 (495-547)||(50023-50075)
scaffold0056 (495-547)||(55124-55176)
[»] scaffold1001 (1 HSPs)
scaffold1001 (489-548)||(2775-2834)
[»] scaffold0176 (2 HSPs)
scaffold0176 (486-588)||(21959-22061)
scaffold0176 (490-524)||(21694-21728)
[»] scaffold0373 (1 HSPs)
scaffold0373 (486-547)||(8541-8602)
[»] scaffold0210 (2 HSPs)
scaffold0210 (491-548)||(14696-14753)
scaffold0210 (491-548)||(14956-15013)
[»] scaffold0179 (1 HSPs)
scaffold0179 (491-548)||(3235-3292)
[»] scaffold0005 (3 HSPs)
scaffold0005 (490-547)||(47923-47980)
scaffold0005 (495-542)||(48181-48228)
scaffold0005 (485-542)||(223122-223179)
[»] scaffold0001 (2 HSPs)
scaffold0001 (492-588)||(148186-148282)
scaffold0001 (490-542)||(147888-147937)
[»] scaffold0684 (2 HSPs)
scaffold0684 (486-542)||(2610-2666)
scaffold0684 (491-540)||(2333-2382)
[»] scaffold0535 (2 HSPs)
scaffold0535 (492-548)||(8972-9028)
scaffold0535 (494-548)||(8734-8788)
[»] scaffold0326 (4 HSPs)
scaffold0326 (490-542)||(4238-4290)
scaffold0326 (490-542)||(19420-19472)
scaffold0326 (491-542)||(4040-4091)
scaffold0326 (491-542)||(19222-19273)
[»] scaffold0007 (2 HSPs)
scaffold0007 (491-542)||(2500-2551)
scaffold0007 (492-534)||(2841-2883)
[»] scaffold0712 (1 HSPs)
scaffold0712 (490-540)||(5207-5257)
[»] scaffold0709 (1 HSPs)
scaffold0709 (490-540)||(5227-5277)
[»] scaffold0370 (1 HSPs)
scaffold0370 (489-547)||(234-292)
[»] scaffold0065 (2 HSPs)
scaffold0065 (490-548)||(3862-3920)
scaffold0065 (492-542)||(3532-3582)
[»] scaffold0811 (2 HSPs)
scaffold0811 (490-547)||(1309-1366)
scaffold0811 (490-547)||(1589-1646)
[»] scaffold0085 (2 HSPs)
scaffold0085 (491-548)||(35028-35085)
scaffold0085 (495-587)||(34724-34816)
[»] scaffold0021 (2 HSPs)
scaffold0021 (492-588)||(12182-12278)
scaffold0021 (492-542)||(12486-12536)
[»] scaffold0016 (2 HSPs)
scaffold0016 (491-548)||(10459-10516)
scaffold0016 (492-542)||(10168-10218)
[»] scaffold0011 (3 HSPs)
scaffold0011 (491-544)||(189328-189381)
scaffold0011 (490-540)||(189630-189680)
scaffold0011 (490-547)||(61630-61687)
[»] scaffold0051 (2 HSPs)
scaffold0051 (490-542)||(5397-5449)
scaffold0051 (488-547)||(5653-5712)
[»] scaffold0159 (1 HSPs)
scaffold0159 (492-547)||(34931-34986)
[»] scaffold0347 (2 HSPs)
scaffold0347 (492-538)||(4266-4312)
scaffold0347 (499-547)||(4016-4064)
[»] scaffold0337 (1 HSPs)
scaffold0337 (492-542)||(12525-12575)
[»] scaffold0123 (1 HSPs)
scaffold0123 (486-548)||(17987-18049)
[»] scaffold0002 (2 HSPs)
scaffold0002 (491-580)||(94056-94145)
scaffold0002 (493-540)||(94282-94329)
[»] scaffold0166 (1 HSPs)
scaffold0166 (491-548)||(24371-24428)
[»] scaffold0078 (2 HSPs)
scaffold0078 (491-540)||(3751-3800)
scaffold0078 (491-587)||(3984-4080)
[»] scaffold0119 (1 HSPs)
scaffold0119 (492-548)||(16724-16780)
[»] scaffold0105 (1 HSPs)
scaffold0105 (492-548)||(17910-17966)
[»] scaffold0060 (2 HSPs)
scaffold0060 (490-542)||(8328-8380)
scaffold0060 (490-542)||(8592-8644)
[»] scaffold0578 (1 HSPs)
scaffold0578 (490-548)||(5014-5072)
[»] scaffold0472 (1 HSPs)
scaffold0472 (486-540)||(7216-7270)
[»] scaffold0204 (1 HSPs)
scaffold0204 (494-546)||(17126-17178)
[»] scaffold0008 (1 HSPs)
scaffold0008 (492-540)||(44158-44206)
[»] scaffold0339 (1 HSPs)
scaffold0339 (492-542)||(3405-3455)
[»] scaffold0562 (1 HSPs)
scaffold0562 (486-523)||(9916-9953)


Alignment Details
Target: chr2 (Bit Score: 647; Significance: 0; HSPs: 178)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 647; E-Value: 0
Query Start/End: Original strand, 8 - 811
Target Start/End: Original strand, 32475608 - 32476419
Alignment:
8 cttatatctctgtggttgagttgactgttgattagatctacatgattcttcaaacttgagagtgtcacatcatttcagacccttaacatatattgtttcc 107  Q
    ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||    
32475608 cttatgtctctgtgattgagttgactgttgattagatctacatgattcttcaaacttgagagcgtcgcatcatttcagacccttaacatatattgtttcc 32475707  T
108 cccgttgtggtatatttcacttagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagcta 207  Q
     || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
32475708 tccattgtggtatatttcacttagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgaaaacatacaagcta 32475807  T
208 atttatagaagattatgtgtgtcgtggatcacaaaatatgtcggtgcaagacgaacatagaaaaaatcatgaactgaatagtttcaaattatataatttg 307  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32475808 atttatagaagattatgtgtgtcgtggaccacaaaatatgtcggtgcaagacgaacatagaaaaaatcatgaactgaatagtttcaaattatataatttg 32475907  T
308 agccctccctcaccatataaagtaagaattttaacag---tcttgaaccagttcagattatataatccaaacatttcttggtcatgttcggataatatca 404  Q
    |||||||||||||||||||||||||||||||||||||   ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
32475908 agccctccctcaccatataaagtaagaattttaacagtactcttgaaccagttcatattatataatccaaacatttcttggtcgtgttcggataatatca 32476007  T
405 ttcgaaatagttcagagtttcgatggttacttgttcagcaagagtaacttattgaacatgtttttctttggattttaccagttttaaggctaaaatatgg 504  Q
    |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||    
32476008 ttcgaaatagttcaaagtttcgatggttacttgctcagcaagagtaacttattgaacatgtttttctttggtttttaccagtttcaaggctaaaatatgg 32476107  T
505 ttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttgatccgttttacattcc 604  Q
    |||||||||||||||||||||||| ||||||||||||| |||||         || ||||||||||||||||||||||||||| || |||||||||||||    
32476108 ttttgatccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttaattcgttttacattcc 32476207  T
605 ttggtttcttcttcctcattagagattggtggtggtgagtaggtgacttcttttgcggagaggaagagagacgaaggagtatggtgtggggtgtatgtgt 704  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||| |||||||||||||||||||||||||||    
32476208 ttggtttcttcttcctcattagagattggtggtggtgagtaggtgacttcttttgtggagagggagggagacaaaggagtatggtgtggggtgtatgtgt 32476307  T
705 gtctgagtgagagaga-----gtggtgcggtgtgttagttttccaacttttggcattttttcgtcgaaattctttgaacgagagattctatcatttgact 799  Q
    ||||||||||||||||     |||||| |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||    
32476308 gtctgagtgagagagaatggtgtggtgtggtgtgttagttttccaacttttggcatttttttctcgaaattctttgaacgagagattctatcatttgact 32476407  T
800 ttgaacttcctt 811  Q
    ||||||||||||    
32476408 ttgaacttcctt 32476419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 585 - 732
Target Start/End: Original strand, 39923732 - 39923881
Alignment:
585 tttgatccgttttacattccttggtttcttcttcctcattagagattggtggtggtgagtaggtgacttcttttgcggagaggaagagagacgaagga-- 682  Q
    ||||||||||||||||||||||||||||||||||||||||| || | ||||||||||| | |||||||| ||||||||||||| ||||||||||||||      
39923732 tttgatccgttttacattccttggtttcttcttcctcattaaaggtaggtggtggtgactcggtgacttattttgcggagagggagagagacgaaggagt 39923831  T
683 --gtatggtgtggggtgtatgtgtgtctgagtgagagagagtggtgcggtgt 732  Q
      |||||||||||||||||| ||||| |  |||||||||| ||||| |||||    
39923832 atgtatggtgtggggtgtatttgtgtat--gtgagagagaatggtgtggtgt 39923881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 29859878 - 29859776
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
29859878 ttttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaatttttgttgtttttggtccctgcaaaatatt 29859779  T
586 ttg 588  Q
    |||    
29859778 ttg 29859776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 487 - 585
Target Start/End: Complemental strand, 2481562 - 2481464
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
2481562 tttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 2481464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 488 - 588
Target Start/End: Complemental strand, 15842827 - 15842727
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || |||||||||||||||||||||||||||    
15842827 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatatttt 15842728  T
588 g 588  Q
    |    
15842727 g 15842727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 491 - 590
Target Start/End: Complemental strand, 16523326 - 16523227
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttgat 590  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||| |||||||||||||||    
16523326 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgat 16523227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 14003744 - 14003646
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
14003744 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattttg 14003646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 25705083 - 25705181
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
25705083 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 25705181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 33575746 - 33575848
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||          || |||||||||||||||||||||||||    
33575746 tttttaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatt 33575845  T
586 ttg 588  Q
    |||    
33575846 ttg 33575848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 1138360 - 1138263
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||         || ||||||||||||||||||||||||||||    
1138360 aggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaattttttgttgttgtttttggtccctgcaaaatattttg 1138263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 487 - 580
Target Start/End: Original strand, 4423890 - 4423983
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||    
4423890 tttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 4423983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 13215059 - 13215156
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
13215059 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttg 13215156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 24358615 - 24358712
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
24358615 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatattttg 24358712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 490 - 582
Target Start/End: Original strand, 4042608 - 4042699
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat 582  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||         || ||||||||||||||||||||||    
4042608 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag-tcctgtaaattttttttgttgtttttggtccctgcaaaat 4042699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 20131681 - 20131585
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
20131681 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 20131585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 24358947 - 24358890
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
24358947 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 24358890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 493 - 588
Target Start/End: Complemental strand, 42696202 - 42696107
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| | |||         || ||||||||| ||||||||||||||||||    
42696202 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccatgtaaaaaaaatttgttgtttttgatccctgcaaaatattttg 42696107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 16522988 - 16523047
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
16522988 taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 16523047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 40125295 - 40125193
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||| ||||| |||||||||||||||||| |||| |||||||| |||||         || |||||||||||||||||||||||||    
40125295 ttttaaggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 40125196  T
586 ttg 588  Q
    |||    
40125195 ttg 40125193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 8046327 - 8046385
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||    
8046327 aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt 8046385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 146690 - 146594
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| ||||||||||||||  |||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
146690 ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 146594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 587
Target Start/End: Complemental strand, 16673772 - 16673676
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||          || |||||||||||||||||||||||||||    
16673772 aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatttt 16673676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 33732857 - 33732918
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
33732857 tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 33732918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 580
Target Start/End: Original strand, 40124966 - 40125054
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||         || ||||||||||||||||||||    
40124966 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgtaatttttttttgttgtttttggtccctgcaaa 40125054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 489 - 580
Target Start/End: Original strand, 18113086 - 18113177
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||         || ||||||||||||||||||||    
18113086 taaggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 18113177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 22881607 - 22881663
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
22881607 ttttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 22881663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 25705450 - 25705394
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
25705450 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25705394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 489 - 580
Target Start/End: Complemental strand, 36815838 - 36815747
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||         || ||||||||||||||||||||    
36815838 taaggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgtaatttttttttgttgtttttggtccctgcaaa 36815747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||    
4794130 ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 4794185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
5334751 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5334806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 5335040 - 5334985
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
5335040 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 5334985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 10374775 - 10374830
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
10374775 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 10374830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 487 - 542
Target Start/End: Complemental strand, 17541781 - 17541726
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
17541781 tttaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 17541726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 43672320 - 43672222
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||| ||||| ||||||||||||||  | |||||||||||||| |||||         |||||||||||||||||||||||||||||||    
43672320 aaggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaaaaattttttattgtttttggtccctgcaaaatattttg 43672222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 4424187 - 4424129
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
4424187 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 4424129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 485 - 547
Target Start/End: Original strand, 14003402 - 14003464
Alignment:
485 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
14003402 gtttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 14003464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 16900209 - 16900151
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
16900209 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 16900151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 16993600 - 16993542
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
16993600 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 16993542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 24483893 - 24483835
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
24483893 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 24483835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 37272105 - 37272047
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
37272105 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37272047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 494 - 547
Target Start/End: Original strand, 146328 - 146381
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
146328 ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 146381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 11788417 - 11788321
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
11788417 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt-aattttttttgttgtttttggtccctgcaaaatattttg 11788321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 19184153 - 19184096
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
19184153 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 19184096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 20131311 - 20131372
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
20131311 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 20131372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 26814231 - 26814174
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
26814231 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 26814174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 494 - 587
Target Start/End: Complemental strand, 29182440 - 29182348
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||| |||||||||||||||||||| |||||||||||||||||| ||||         || |||||||||||||||||||||||||||    
29182440 ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtttctgt-aaaaaaaattgttgtttttggtccctgcaaaatatttt 29182348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 30215420 - 30215477
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
30215420 aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 30215477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 485 - 542
Target Start/End: Original strand, 31644834 - 31644891
Alignment:
485 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||    
31644834 gtttaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 31644891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 33576119 - 33576062
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
33576119 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 33576062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 580
Target Start/End: Original strand, 34317798 - 34317886
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||    
34317798 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa 34317886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 37271737 - 37271794
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
37271737 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37271794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 37910755 - 37910851
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||||| |||||||||||||| |||| |||||||| |||||         || ||||||||||||||||||||||||||||    
37910755 aggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatattttg 37910851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 38980255 - 38980198
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
38980255 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 38980198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 43671929 - 43671990
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||  |||||| |||||||| ||||||||||||||||||||||    
43671929 tttaaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgt 43671990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 44559061 - 44559118
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
44559061 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 44559118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 44985985 - 44985928
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||    
44985985 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt 44985928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 9195054 - 9195110
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
9195054 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 9195110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
15842464 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 15842516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 20939329 - 20939269
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
20939329 ttaacgctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 20939269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
29859490 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29859542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 488 - 540
Target Start/End: Complemental strand, 37911124 - 37911072
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||||||| ||||||||||||||| ||||||||||||||    
37911124 ttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta 37911072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 41451836 - 41451892
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
41451836 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 41451892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 487 - 547
Target Start/End: Complemental strand, 44073812 - 44073752
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||    
44073812 tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 44073752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 11713847 - 11713749
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||| ||||||  |||||||||||||||||||||||||||||||| |||||          | |||||||||||||||||||||| |||||    
11713847 aaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaataattttgtttttggtccctgcaaaattttttg 11713749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 582
Target Start/End: Original strand, 23732039 - 23732129
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat 582  Q
    |||||||||||| |||||||||||||||||||| ||||||||||||||||| | |||         || ||||||||||||||||||||||    
23732039 ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaaat 23732129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 38731826 - 38731885
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||| |||||  |||||||||||||||||||||||||||||||| |||||    
38731826 taaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt 38731885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 40301973 - 40302071
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||  |||||||||||||||||| |||| |||||||| |||||          | ||||||||||||||||||||||||||||    
40301973 aaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattttg 40302071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 43788857 - 43788908
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
43788857 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 43788908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 1137983 - 1138037
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| || |||||    
1137983 ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgt 1138037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 580
Target Start/End: Original strand, 10671629 - 10671718
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||||||||||||| |||||||||||||  ||||||||||||||||| |||||         || ||||||||||||||||||||    
10671629 aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaa 10671718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 17302145 - 17302087
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| | |||||||||||| ||||||||||||||||| |||||    
17302145 aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt 17302087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 27109073 - 27109123
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| ||||| ||||||||||||||||||||||||||    
27109073 ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt 27109123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 31225713 - 31225771
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| |||||  |||||||||||||||||||||||| |||||||||||||    
31225713 aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgt 31225771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 36815487 - 36815584
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||  | ||| ||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
36815487 aggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 36815584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 40302340 - 40302243
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||          | |||||||||||||||||||||| |||||    
40302340 aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgtaaacaaaaaattttgtttttggtccctgcaaaattttttg 40302243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 42358697 - 42358755
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
42358697 aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 42358755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 42695868 - 42695918
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |||||||||||||| |||||||||||||||||    
42695868 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 42695918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 44985623 - 44985677
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
44985623 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 44985677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 9195207 - 9195150
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||   ||||||||||||||||||||||||||||||| |||||    
9195207 aggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgt 9195150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 16673409 - 16673466
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||    
16673409 aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg 16673466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 17541380 - 17541437
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||| ||||||||||||||||||||||||||| ||||    
17541380 aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg 17541437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 19183780 - 19183837
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
19183780 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 19183837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 26707872 - 26707929
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||||||||||| | |||||||||||||||| |||||    
26707872 aggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgt 26707929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 35686335 - 35686282
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||| |||||||| ||||||||||||||||| ||||    
35686335 taaaatatggttttgatccctgtaaatatgcttcgttttggttttagtttctgt 35686282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 496 - 588
Target Start/End: Complemental strand, 36806892 - 36806800
Alignment:
496 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || || ||||||||||||| |||||||||||    
36806892 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttatttttggtccctgtaaaatattttg 36806800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 43592045 - 43592102
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
43592045 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt 43592102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 43597153 - 43597210
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  | |||||||||||||||||||||||||||||| |||||    
43597153 aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt 43597210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 486 - 547
Target Start/End: Complemental strand, 43789198 - 43789137
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||||  | ||||||||||||| |||||||||||||||| ||||    
43789198 ttttaaggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg 43789137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 3172018 - 3172070
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| ||||| |||||||||||||||||| |||||||||||||    
3172018 aaggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagt 3172070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 3172534 - 3172482
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| ||||| ||| ||||||||||||||||||||||||||||    
3172534 aaggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagt 3172482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 3671192 - 3671136
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||  |||||||||||||||||||||||||||||||| |||||    
3671192 ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 3671136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 493 - 588
Target Start/End: Complemental strand, 3838263 - 3838168
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||          | |||||||||||||||||||||| |||||    
3838263 gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaattttttg 3838168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 8046648 - 8046592
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||||| |||||||||||||||||||||||||| |||||    
8046648 ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 8046592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 11713485 - 11713541
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
11713485 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 11713541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 587
Target Start/End: Complemental strand, 18113454 - 18113359
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||||||||||| ||||| ||||||||| |||||||||||||| | |||||         || |||||||| ||||||||||||||||||    
18113454 ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgtaaattttttttgttgtttttagtccctgcaaaatatttt 18113359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 538
Target Start/End: Complemental strand, 23732330 - 23732282
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||||| || |||||||||||||||||||||||||    
23732330 aaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttt 23732282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 23989832 - 23989888
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||| ||||  ||||||||||||||||||||||||||||||||    
23989832 tttttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 23989888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 538
Target Start/End: Original strand, 27310874 - 27310922
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||    
27310874 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt 27310922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 538
Target Start/End: Original strand, 29831812 - 29831860
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    ||||||||||||| ||||||||||||||||||||| |||||||||||||    
29831812 aaggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt 29831860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 31226077 - 31226029
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
31226077 ggctaaaatatggttttactccctgcaaatatgcctcgttttggtttta 31226029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 33733241 - 33733193
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
33733241 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 33733193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 36622250 - 36622306
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
36622250 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 36622306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 37228731 - 37228783
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||| ||||||||||||||  ||||||||||||||||    
37228731 aaggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagt 37228783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 41694003 - 41693947
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
41694003 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 41693947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 44559407 - 44559359
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||||    
44559407 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 44559359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 44994063 - 44994011
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| ||||||||||||||| |||||||| ||||||||    
44994063 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagt 44994011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 494 - 588
Target Start/End: Complemental strand, 1497943 - 1497849
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||  ||| |||||||||||||||||||||||||||| ||||          || |||||||||||||||||||||| |||||    
1497943 ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctgcagaactttttttttgtttttggtccctgcaaaattttttg 1497849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 5790558 - 5790613
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||| ||  |||||||||||||||||||||||||||||||| ||||    
5790558 ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg 5790613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
5790899 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 5790844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 485 - 548
Target Start/End: Complemental strand, 7814744 - 7814681
Alignment:
485 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||| ||||||||||||| ||||  |||||||||||||||||| ||||||||||||| |||||    
7814744 gtttttaggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt 7814681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 10671942 - 10671891
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
10671942 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 10671891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 26813866 - 26813921
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
26813866 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 26813921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 27311070 - 27311019
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||| ||||||||||||||||||||||||||||    
27311070 aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagt 27311019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 29865222 - 29865277
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
29865222 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 29865277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 30215872 - 30215774
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||  | ||||||||||||||| |||||          || ||||||||||||||||||||||||||||    
30215872 aggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttg 30215774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 31326254 - 31326156
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||| |||||  ||| ||||||||||||||||||| |||||||| |||||         || |||||||||||||||||||||| |||||    
31326254 aaggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaaaataaaatttttgtttttggtccctgcaaaattttttg 31326156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 31909479 - 31909429
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||||||    
31909479 aggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagt 31909429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 38639411 - 38639462
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
38639411 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 38639462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 39367762 - 39367664
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||| |||||||||| |||||||| |  |||||||||||||  ||||         || ||||||||||||||||||||||||||||    
39367762 aaggctaaaatatggtcttgatccctgtaaatatgctttattttggttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 39367664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 4042890 - 4042840
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||| | |||||||||||||| |||||||||||||||||    
4042890 ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagt 4042840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 10665296 - 10665238
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| |||||  || |||||||||||| ||||||||||||||||||||||    
10665296 aaggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgt 10665238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 34318083 - 34318033
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| ||||| |||||||||||||||||| |||||||    
34318083 ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagt 34318033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 36622582 - 36622528
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  ||||||||||||||| ||||||||||||||||| ||||    
36622582 ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtttctgt 36622528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 40786454 - 40786516
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||||||  || ||||||||||| ||||||||||||||||| |||||    
40786454 tttttaggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgt 40786516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 41693672 - 41693730
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||  |||||||||||||||| |||||    
41693672 aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt 41693730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 1295544 - 1295491
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| ||||||||||||  |||||||||||||||| |||||    
1295544 taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgt 1295491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 2481191 - 2481248
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| | | |||||||||| ||||||||||||||||| ||||    
2481191 aaggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg 2481248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #128
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 3671002 - 3671059
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||| |||||||||||||||||||| ||||||| |||||    
3671002 aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt 3671059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #129
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 7814244 - 7814301
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||| |||||  |||||| ||||||||||||||||||||||||| ||||    
7814244 aaggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg 7814301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #130
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 12835325 - 12835421
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||| ||||  |||||||||||||||||| ||||||||||||| |||||          | |||||||||||| |||||||||||||||    
12835325 ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtctctgcaaaatattttg 12835421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #131
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 13850521 - 13850578
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||||||| ||||||||||| |||| |||||||||||| |||||    
13850521 aggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgt 13850578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #132
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 20658060 - 20658117
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||| ||||||||  ||||||||||||||||| |||||||||||||| |||||    
20658060 aggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 20658117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #133
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 29865512 - 29865455
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||| ||||||||||| |||||||||||||||| |||||    
29865512 aggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgt 29865455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #134
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 492 - 541
Target Start/End: Complemental strand, 34964159 - 34964110
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||||||||||||||||| |||||||||||||| |||||||| |||||||    
34964159 ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttag 34964110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #135
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 43710713 - 43710652
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| ||||   || |||||||||||||||||||||||||||| |||||    
43710713 tttaaggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgt 43710652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #136
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 1497610 - 1497666
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||| |||||||||||||||||||| ||||||| |||||    
1497610 ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt 1497666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #137
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 2265401 - 2265341
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||| ||||  ||| |||||||||| ||||||||||||||||| |||||    
2265401 ttaaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgt 2265341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #138
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 10375069 - 10375021
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||    
10375069 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 10375021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #139
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 539
Target Start/End: Complemental strand, 13215366 - 13215318
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||| |||| |||||||||||||| ||||||||||||||    
13215366 aggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt 13215318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #140
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 488 - 548
Target Start/End: Original strand, 16968548 - 16968608
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||| ||||||||||||||  ||||| ||||||||||| |||||||||||||| |||||    
16968548 ttaaggttaaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgt 16968608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #141
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 539
Target Start/End: Complemental strand, 20658410 - 20658362
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||||| ||||||||||||||| ||||||||| ||||    
20658410 aggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt 20658362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #142
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 26239161 - 26239105
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| ||||    
26239161 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 26239105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #143
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 38231431 - 38231487
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||||||||||||||||| ||| |||||| ||||||| |||||    
38231431 ggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgt 38231487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #144
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 43597503 - 43597443
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||| ||||  ||||||| |||||| ||||||||||||||||| |||||    
43597503 ttaaggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt 43597443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #145
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 3832634 - 3832587
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| ||||||||||||||  ||||||||||||||||    
3832634 taaaatatggttttggtccctgcaaatatgtttcgttttggttttagt 3832587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #146
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 13850881 - 13850834
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| | ||||||||||||| ||||||||||||||||    
13850881 taaaatatggttttggttcctgcaaatatgcttcgttttggttttagt 13850834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #147
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 17912808 - 17912761
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||  | ||||||||||||||||||||||||||||||    
17912808 taaaatatggttttagttcctgcaaatatgcctcgttttggttttagt 17912761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #148
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 24483401 - 24483456
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| |||  ||| |||||||||||||||||||||||||||| |||||    
24483401 gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgt 24483456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #149
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 25954429 - 25954370
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||| ||||||||||||||  ||| |||||||||||||||||||| ||||||| |||||    
25954429 taaggttaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt 25954370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #150
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 487 - 542
Target Start/End: Complemental strand, 38231826 - 38231771
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||| ||||||||| ||||||||||| ||||||||| |||||||| |||||||    
38231826 tttaaggttaaaatatgattttgatccctccaaatatgcttcgttttgattttagt 38231771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #151
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 3837931 - 3837989
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| |||||  |||||||||||||| |||||||| |||||||| |||||    
3837931 aaggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgt 3837989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #152
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 5006605 - 5006663
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||| || ||||||||||  |||||||||||||||||| ||||    
5006605 aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagtttctgt 5006663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #153
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 26238811 - 26238869
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
26238811 aaggttaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 26238869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #154
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 35155621 - 35155563
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||| ||||||| || |||||| ||||||| |||||    
35155621 aaggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgt 35155563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #155
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 41791020 - 41791074
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  |||||| ||||||||||| ||||||||||||| |||||    
41791020 ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt 41791074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #156
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 538
Target Start/End: Complemental strand, 41791312 - 41791266
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||  ||||||||||||||| ||||||||||||    
41791312 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttt 41791266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #157
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 497 - 542
Target Start/End: Complemental strand, 4794468 - 4794423
Alignment:
497 aaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| ||||| |||||||| |||||||||||||||||    
4794468 aaatatggttttggtccctacaaatatgtctcgttttggttttagt 4794423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #158
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 4842865 - 4842914
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||   |||||||||||| |||||||||||||||||    
4842865 gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagt 4842914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #159
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 10664983 - 10665040
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| | ||||| |||||    
10664983 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgt 10665040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #160
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 19831503 - 19831564
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||| ||||||||||||||  ||  ||||||||||  ||||||||||||||||||||||    
19831503 tttaaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt 19831564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #161
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 32691312 - 32691361
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||  |  |||||||||||||||||||||||||||    
32691312 aggctaaaatatggttttagtttctgcaaatatgcctcgttttggtttta 32691361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #162
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 489 - 542
Target Start/End: Complemental strand, 45442699 - 45442646
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| ||||  ||| |||||||||| |||||||||||||||||    
45442699 taaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagt 45442646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #163
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 494 - 546
Target Start/End: Complemental strand, 25300038 - 25299987
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 546  Q
    |||||||||||||||| ||||||||||||||  || |||||||||||||||||    
25300038 ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagttcct 25299987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #164
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 25954113 - 25954165
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| ||||  ||||||||||||||  ||||||||||||||||    
25954113 aaggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagt 25954165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #165
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 31325920 - 31325976
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| |  ||||||||||||||| ||||||| |||||||| |||||    
31325920 ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgt 31325976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #166
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 498 - 542
Target Start/End: Original strand, 35155298 - 35155342
Alignment:
498 aatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||  |||||||||||||| |||||||||||||||||    
35155298 aatatggttttagtccctgcaaatatgtctcgttttggttttagt 35155342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #167
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 495 - 543
Target Start/End: Complemental strand, 37229039 - 37228991
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 543  Q
    ||||||||||||||| |||||||||||||   |||||||||||||||||    
37229039 taaaatatggttttggtccctgcaaatatatttcgttttggttttagtt 37228991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #168
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 17912452 - 17912499
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||| ||||  |||||||||||||| |||||||||||||||||    
17912452 taaaatatgattttagtccctgcaaatatgtctcgttttggttttagt 17912499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #169
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 23990193 - 23990146
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||  ||| |||||||||| |||||||||||||||||    
23990193 taaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 23990146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #170
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 14393132 - 14393079
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||| ||| | ||| |||||||||| |||||||||||||||||    
14393132 ttaaggctaaaatatgatttagttcc-tgcaaatatgtctcgttttggttttagt 14393079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #171
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 25299747 - 25299801
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||| ||||| |||||||||||||| ||||||||  ||||||| |||||    
25299747 ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgt 25299801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #172
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||| |||||||||||||||||||||||||||||    
29831885 ttttggtccctgcaaatatgcctcgttttggtttt 29831919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #173
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 487 - 540
Target Start/End: Original strand, 13802481 - 13802534
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||||||  | | || |||||| ||||||||||||||||    
13802481 tttaaggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta 13802534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #174
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 540
Target Start/End: Complemental strand, 16900129 - 16900100
Alignment:
511 tccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||||||||||||||    
16900129 tccctgcaaatatgcctcgttttggtttta 16900100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #175
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 540
Target Start/End: Complemental strand, 16993520 - 16993491
Alignment:
511 tccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||||||||||||||    
16993520 tccctgcaaatatgcctcgttttggtttta 16993491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #176
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 548
Target Start/End: Complemental strand, 22881949 - 22881912
Alignment:
511 tccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||| ||||||||||||||||| |||||    
22881949 tccctgcaaatatgtctcgttttggttttagtccctgt 22881912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #177
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 34963796 - 34963845
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||||||| ||||||  | |||||| |||||||    
34963796 gctaaaatatggttttgatccctgctaatatgttttgttttgattttagt 34963845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #178
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||  || ||||||||||| ||||||||| |||||    
45442315 aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta 45442364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 76; Significance: 1e-34; HSPs: 165)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 589 - 721
Target Start/End: Complemental strand, 2059361 - 2059225
Alignment:
589 atccgttttacattccttggtttcttcttcctcattagagattggtggtggtgagtaggtgacttcttttgcggagaggaagagagacgaaggagt---- 684  Q
    |||||||||||||||||||||||||||||||||||||||| || | ||||||||||  ||||||||||||||||||| | |||| |||||||||||        
2059361 atccgttttacattccttggtttcttcttcctcattagaggttagcggtggtgagtcagtgacttcttttgcggagaaggagagtgacgaaggagtatgc 2059262  T
685 atggtgtggggtgtatgtgtgtctgagtgagagagag 721  Q
    |||||||||||||||| ||||| || |||||||||||    
2059261 atggtgtggggtgtatttgtgtgtgtgtgagagagag 2059225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 490 - 585
Target Start/End: Complemental strand, 19685382 - 19685287
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
19685382 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 19685287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 1381245 - 1381343
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
1381245 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 1381343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 491 - 585
Target Start/End: Complemental strand, 24443745 - 24443651
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
24443745 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 24443651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 40764782 - 40764684
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
40764782 aaggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaaatattttg 40764684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 28872000 - 28871938
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
28872000 ttttaaggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt 28871938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 488 - 584
Target Start/End: Complemental strand, 5917464 - 5917368
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat 584  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||    
5917464 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatat 5917368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 35928458 - 35928362
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
35928458 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 35928362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 485 - 588
Target Start/End: Original strand, 29692737 - 29692840
Alignment:
485 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat 584  Q
    ||||| ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||          | ||||||||||||||||||||||||    
29692737 gtttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaagttttgtttttggtccctgcaaaatat 29692836  T
585 tttg 588  Q
    ||||    
29692837 tttg 29692840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 487 - 547
Target Start/End: Original strand, 40764410 - 40764470
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
40764410 tttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 40764470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 488 - 547
Target Start/End: Complemental strand, 1381615 - 1381556
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
1381615 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1381556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 5614536 - 5614434
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||          | |||||||||||||||||||||| ||    
5614536 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaatttt 5614437  T
586 ttg 588  Q
    |||    
5614436 ttg 5614434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 19565465 - 19565563
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
19565465 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 19565563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 20986091 - 20985993
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||          || ||||||||||||||||||||||||||||    
20986091 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 20985993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 491 - 585
Target Start/End: Original strand, 37271358 - 37271452
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    ||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
37271358 aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 37271452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 5917125 - 5917222
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
5917125 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 5917222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 35877053 - 35876956
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||  |||||         || ||||||||||||||||||||||||||||    
35877053 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 35876956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 38170512 - 38170570
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
38170512 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 38170570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 30888160 - 30888256
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||| |||||    
30888160 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtagaattttttttttgtttttggtccctgcaaaattttttg 30888256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 35928062 - 35928119
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
35928062 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35928119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 485 - 588
Target Start/End: Original strand, 45131 - 45234
Alignment:
485 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat 584  Q
    |||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||| ||| ||||||||||    
45131 gttttatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttgatccttgcaaaatat 45230  T
585 tttg 588  Q
    ||||    
45231 tttg 45234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 582
Target Start/End: Original strand, 1104857 - 1104948
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat 582  Q
    ||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||         || ||||||||||||||||||||||    
1104857 aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaat 1104948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 1105149 - 1105093
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
1105149 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 1105093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 493 - 588
Target Start/End: Complemental strand, 2636992 - 2636898
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||         || ||||||||||||| ||||||||||||||    
2636992 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttag-tcctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg 2636898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 19565832 - 19565776
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
19565832 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 19565776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 20660946 - 20660998
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||    
20660946 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 20660998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 2217492 - 2217590
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||           ||||||||||||||||||||||| |||||    
2217492 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttg 2217590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 6912497 - 6912552
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
6912497 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 6912552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 18258529 - 18258431
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| | |||         || |||||||||||||| |||||||||||||    
18258529 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccccgcaaaatattttg 18258431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 26071618 - 26071521
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||| ||||||||| |||||||||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
26071618 aaggttaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgtaatttttgttt-ttgtttttggtccctgcaaaatattttg 26071521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 4203452 - 4203506
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
4203452 ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 4203506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 5904007 - 5904104
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| ||| |||||||||||||||||||| ||||||| |||||         || ||||||||| ||||||||||||||||||    
5904007 aggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgtaaattatttttgttgtttttgatccctgcaaaatattttg 5904104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 5950170 - 5950232
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
5950170 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 5950232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 494 - 587
Target Start/End: Complemental strand, 6912855 - 6912762
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||| |||||||||||||    
6912855 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccatgcaaaatatttt 6912762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 7075570 - 7075628
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
7075570 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 7075628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 492 - 585
Target Start/End: Complemental strand, 20661311 - 20661218
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||| ||| ||||||||||| |||||||||||||||| |||||         || |||||||||||||||||||||||||    
20661311 ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatatt 20661218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 21124911 - 21124969
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||    
21124911 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt 21124969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 24443377 - 24443435
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||    
24443377 taaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 24443435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 28863508 - 28863566
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
28863508 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 28863566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 29151854 - 29151796
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  | |||||||||||||||||||||||||||||||||||    
29151854 taaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg 29151796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 29172889 - 29172831
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
29172889 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 29172831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 29875397 - 29875455
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||    
29875397 taaggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg 29875455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 36578085 - 36578027
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
36578085 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 36578027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 4736547 - 4736486
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||| ||||||||||||||  |||||||||||||||| |||||    
4736547 tttaaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgt 4736486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 18633597 - 18633654
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
18633597 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 18633654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Complemental strand, 29875731 - 29875670
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
29875731 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 29875670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 30800493 - 30800550
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
30800493 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 30800550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 30800851 - 30800794
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
30800851 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 30800794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 35167167 - 35167110
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
35167167 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 35167110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 35876686 - 35876743
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
35876686 aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 35876743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 36973710 - 36973614
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||| ||||||| ||||||||| ||||||| |||||         || ||||||||||||||||||||||||||||    
36973710 ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 36973614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 40038493 - 40038542
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||    
40038493 aggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta 40038542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 40038858 - 40038762
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||| ||||| ||||||||||||||||| |||||||||||| | |||||         || ||||||||||||||||||||||||||||    
40038858 ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 40038762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 42596448 - 42596509
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||||||||| ||||||||  || ||||||||||||||||||||    
42596448 tttaaggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctgt 42596509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 10743722 - 10743774
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
10743722 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 10743774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 16038375 - 16038427
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
16038375 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 16038427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 19685016 - 19685072
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
19685016 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 19685072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
20985728 taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 20985780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 28213371 - 28213423
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||| |||||||||||||||||| |||||||||||||    
28213371 aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt 28213423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 28550827 - 28550883
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
28550827 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 28550883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 28863838 - 28863782
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
28863838 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 28863782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 29366949 - 29366893
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
29366949 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 29366893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 494 - 546
Target Start/End: Complemental strand, 35609635 - 35609583
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 546  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||||||||    
35609635 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcct 35609583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 40029497 - 40029441
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
40029497 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 40029441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 2217855 - 2217804
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
2217855 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 2217804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 487 - 542
Target Start/End: Complemental strand, 13990900 - 13990845
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| ||||||  ||||||||||||||||||||||||||||||||    
13990900 tttaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt 13990845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 18046349 - 18046298
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
18046349 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 18046298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 20690732 - 20690783
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||||||    
20690732 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 20690783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 15635710 - 15635652
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||| ||||||||||||||||||||||||||| ||||    
15635710 taaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg 15635652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 18258159 - 18258217
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||    
18258159 taaggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg 18258217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 26133415 - 26133357
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
26133415 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 26133357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 493 - 547
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
29172524 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 29172578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 487 - 541
Target Start/End: Original strand, 35166906 - 35166960
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    ||||||||||||||||||||||  ||||||||||||||||| |||||||||||||    
35166906 tttaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag 35166960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 38786157 - 38786215
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
38786157 aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 38786215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 40167784 - 40167842
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||| |||||||||  |||||||||||||||||||||||||||||||| |||||    
40167784 aaggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 40167842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 1286682 - 1286778
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||| ||| ||||| |||||||||||||||||||||||||| |||||         || ||||||||| || |||||||||||||||    
1286682 ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttgatctctgcaaaatattttg 1286778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 10408926 - 10408983
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||    
10408926 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 10408983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 10830528 - 10830585
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| || || ||||||||||| ||||||||||||||||||||    
10830528 aggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgt 10830585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 11799459 - 11799402
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
11799459 aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgt 11799402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 23381949 - 23382006
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| || ||||||||||||||||||||    
23381949 aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt 23382006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 540
Target Start/End: Complemental strand, 25562000 - 25561951
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||    
25562000 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 25561951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 25779163 - 25779106
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||||||||||||||| || |||||||||||||||||||    
25779163 aggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgt 25779106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 26133178 - 26133239
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| |||||||||||||||||  ||||| |||||||||||||||||||||||||| |||||    
26133178 tttatggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 26133239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 28108159 - 28108106
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| ||||| |||||||||||||||||||||||||| |||||    
28108159 taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgt 28108106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 36577721 - 36577778
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
36577721 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 36577778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 37271708 - 37271651
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||    
37271708 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg 37271651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 293826 - 293878
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||||||||||||| |||||||    
293826 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt 293878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 6118499 - 6118451
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
6118499 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 6118451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 10409332 - 10409276
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||||||  |||||||||||||||||||||||| |||||||    
10409332 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt 10409276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 18633961 - 18633913
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
18633961 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 18633913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 27916766 - 27916714
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||  ||||||||||||||||||||||||||||||||    
27916766 aaggttaaaatatggttttattccctgcaaatatgcctcgttttggttttagt 27916714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 33336026 - 33335970
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
33336026 ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt 33335970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 34125301 - 34125357
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| |||||||||||| |||||  ||||||||||||||||||||||||||||||||    
34125301 tttttaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt 34125357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 35609303 - 35609359
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| ||| ||||||||||| |||||||||||||||| |||||    
35609303 ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgt 35609359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 38554750 - 38554799
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||||||||||||||  |||||||||||||||||    
38554750 aggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagt 38554799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 18286744 - 18286685
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||| ||||||||  ||||||||||||| ||||||||||||||||||| ||||    
18286744 taaggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagttactgt 18286685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 25561705 - 25561760
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  ||||||||||||||| |||||||||||||||| ||||    
25561705 ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg 25561760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 34125635 - 34125576
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||  |||||| ||||||||||| ||||||||||||| |||||    
34125635 taaggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt 34125576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 39379611 - 39379560
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
39379611 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 39379560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 1287047 - 1286989
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||| |||||| ||||||| ||| |||||||||||||||||||    
1287047 aaggttaaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgt 1286989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 2636669 - 2636719
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |||||||||||| | |||||||||||||||||    
2636669 ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagt 2636719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 540
Target Start/End: Complemental strand, 9179922 - 9179872
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||||  ||| ||||||||||||||||||||||||||    
9179922 aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta 9179872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 584
Target Start/End: Original strand, 12144906 - 12144998
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat 584  Q
    ||||||||||||||||||  |||||| ||||||||||| ||||||||||||| |||||         || ||||||||||||||||||||||||    
12144906 aggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgtatttttttgtt-ttgtttttggtccctgcaaaatat 12144998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 18046036 - 18046094
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
18046036 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 18046094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 20683741 - 20683803
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||||  || |||||||||||| |||||||| ||||||| |||||    
20683741 ttttaaggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgt 20683803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 23382297 - 23382247
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||||||||||||||||| ||||||||||||||    
23382297 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt 23382247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 537
Target Start/End: Original strand, 31602142 - 31602188
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt 537  Q
    |||||||||||| |||||||||||||||||||||| |||||||||||    
31602142 aggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt 31602188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 38496785 - 38496727
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  ||||||||||||||  |||||||||||||||| ||||    
38496785 taaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg 38496727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 42553642 - 42553692
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||| ||||| |||||||||||||| |||||||||||||||||    
42553642 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt 42553692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 4203771 - 4203714
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
4203771 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 4203714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 10744055 - 10743998
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||| |||||||||| ||||||||||||||||| |||||    
10744055 aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt 10743998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 11799127 - 11799184
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  ||||||||||||||| | |||||||||||||| ||||    
11799127 aaggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg 11799184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 24781988 - 24782045
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  || ||||||||||| ||||||||||||||||| |||||    
24781988 aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt 24782045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 193
Target Start/End: Complemental strand, 26204297 - 26204180
Alignment:
76 atcatttcagacccttaacatatattgtttcccccgttgtggtatatttcacttagtttggtgttcagatcaatgcccgaggtgtccatgattatttggt 175  Q
    ||||||||| ||||| |||||||   ||||||| | |||| ||| | | || |||||||||||||||||||||||   || ||| | |||||||||||||    
26204297 atcatttcaaaccctaaacatattgggtttccctcattgtagtaaactacaattagtttggtgttcagatcaatgattgaagtgcctatgattatttggt 26204198  T
176 gtggtttaaaacatatga 193  Q
    |||||||| |||| ||||    
26204197 gtggtttacaacaaatga 26204180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 540
Target Start/End: Complemental strand, 31037742 - 31037693
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||    
31037742 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 31037693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 496 - 580
Target Start/End: Original strand, 32888691 - 32888775
Alignment:
496 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||| ||||||||||||| ||||||||| |||||||| |||||         || ||||||||||||||||||||    
32888691 aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgtaatttttttttgttgtttttggtccctgcaaa 32888775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 492 - 580
Target Start/End: Original strand, 36973353 - 36973441
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||| || || |||||||| ||||||||||||||||||| |||         || ||||||||||||||||||||    
36973353 ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagttcatgtaaaaaatatttgttgtttttggtccctgcaaa 36973441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 487 - 540
Target Start/End: Original strand, 40029136 - 40029189
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||||||  |||||| ||||||| |||||||||||||||    
40029136 tttaaggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta 40029189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 42596814 - 42596761
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| |||||||||||||| |||||||| |||||||| |||||    
42596814 taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt 42596761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 3850600 - 3850544
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||| ||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
3850600 aggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 3850544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 5104001 - 5103945
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| | |||||||||||| ||| |||||||||||||| ||||    
5104001 ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagtttctgt 5103945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 5614164 - 5614216
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| |||||||    
5614164 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 5614216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 9532537 - 9532485
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||  ||| ||||||||||||||||||||||||||||    
9532537 aaggttaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 9532485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 14318039 - 14318095
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||||||  ||| |||||||||| |||||||||||||||||    
14318039 tttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 14318095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 16038738 - 16038690
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||| ||||  ||||||||||||||||||||||||||||||||    
16038738 ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 16038690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 21050913 - 21050857
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||||||||||||||| |||||||| ||||||| |||||    
21050913 ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgt 21050857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 29693092 - 29693040
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| ||||  ||||||||||||||| ||||||||||||||||    
29693092 aaggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt 29693040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 36278075 - 36278131
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||||||||||||||||||||||  || |||| ||||||||    
36278075 tttttaggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagt 36278131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 544
Target Start/End: Original strand, 38962806 - 38962858
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||||||||||||  |||||| ||||||| |||||||||||||||||||    
38962806 ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttc 38962858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||| ||||  |||||||||||||||||||||||||||||||| ||||    
39379242 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 39379294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 539
Target Start/End: Original strand, 3850299 - 3850346
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||||  ||||||||||| |||||||||||||||||    
3850299 ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt 3850346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 29151516 - 29151571
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||| ||||  |||||||||||||||||||||||| ||||||| ||||    
29151516 ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg 29151571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 38555084 - 38555034
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||| | |||||||||||||||||| |||||||||||||    
38555084 aggctaaaatatggtttgg-tccctgcaaatatgcctcattttggttttagt 38555034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #134
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 2032940 - 2032890
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||| |||||||||  |||||||||||||| |||||||||||||||||    
2032940 ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagt 2032890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #135
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 15916286 - 15916336
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||| ||||||||| |||||||||||||| ||| |||||||||||||    
15916286 ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagt 15916336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #136
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 532
Target Start/End: Original strand, 17070533 - 17070575
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttt 532  Q
    |||||||||||||||||||| |||||||||||||| |||||||    
17070533 aaggctaaaatatggttttggtccctgcaaatatgtctcgttt 17070575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #137
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 488 - 538
Target Start/End: Original strand, 20416356 - 20416406
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||||||  |||||||||||||| |||| ||||||||    
20416356 ttaaggctaaaatatggttttcgtccctgcaaatatgtctcgctttggttt 20416406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #138
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 540
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||| |||||||||||||| ||||||||| |||||    
38452394 ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta 38452348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #139
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 546
Target Start/End: Original strand, 42994068 - 42994122
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 546  Q
    |||||||||||||||||  |||||||||||||| ||||||||| ||||| |||||    
42994068 ggctaaaatatggttttagtccctgcaaatatgactcgttttgattttaattcct 42994122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 540
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||| ||||||||||||||  ||||||||||||||    
45501 taaaatatggttttggtccctgcaaatatgtttcgttttggtttta 45456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #141
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 9179592 - 9179649
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||| ||||||||||  |||||||||||||||| |||||    
9179592 aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgt 9179649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #142
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 494 - 539
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||| |||||||||||||| ||||||||| ||||    
12145181 ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt 12145136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #143
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 15635370 - 15635431
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||| ||||||||||||||  ||| |||||||||| || |||||||||||||| ||||    
15635370 ttttaaggataaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg 15635431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #144
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 26071290 - 26071347
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| |||| | |||||||||||||| ||| ||||||||||||| |||||    
26071290 aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgt 26071347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #145
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 28871640 - 28871693
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||| ||||| ||||||||||||| | |||||||||||||||| |||||    
28871640 taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgt 28871693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #146
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 32108807 - 32108856
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||| ||||||||||||||  ||||||| ||||||    
32108807 aggctaaaatatggttttggtccctgcaaatatgtttcgttttagtttta 32108856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #147
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 40168009 - 40167952
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| |||||  ||| |||||||||| ||||||||||||||||| |||||    
40168009 aggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgt 40167952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #148
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 42207241 - 42207298
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||| || ||||||| ||||||||||||||||| |||||    
42207241 aggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgt 42207298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #149
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 494 - 542
Target Start/End: Original strand, 16616370 - 16616418
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||  |||||||||||||||||| |||| ||||||||    
16616370 ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagt 16616418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #150
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 20691094 - 20691046
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||| ||||| | |||||||||||| |||||||||||||||||    
20691094 ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagt 20691046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #151
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 35166159 - 35166103
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||| |||||||||||  |||||||||| ||| ||||||||||||||||| ||||    
35166159 aggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg 35166103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #152
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 538
Target Start/End: Complemental strand, 38182089 - 38182041
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||||| |  ||||||||||| |||||||||||||    
38182089 aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38182041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #153
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 538
Target Start/End: Original strand, 38189042 - 38189090
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||||| |  ||||||||||| |||||||||||||    
38189042 aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38189090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #154
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 538
Target Start/End: Complemental strand, 38209315 - 38209267
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||||| |  ||||||||||| |||||||||||||    
38209315 aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38209267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #155
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 538
Target Start/End: Original strand, 38216267 - 38216315
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||||| |  ||||||||||| |||||||||||||    
38216267 aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt 38216315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #156
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 42207576 - 42207517
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||| |||||||||||||||  ||| | |||||||||||||||||||||||||| |||||    
42207576 ttaagcctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctgt 42207517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #157
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 29855614 - 29855669
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||| ||||| ||| || ||||||||||| ||||||||||||| |||||    
29855614 gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgt 29855669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #158
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 487 - 542
Target Start/End: Original strand, 31037390 - 31037445
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||| |||||||||||||||  ||||||||||||| ||| |||||| |||||||    
31037390 tttaagactaaaatatggttttagtccctgcaaatataccttgttttgattttagt 31037445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #159
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 766 - 811
Target Start/End: Complemental strand, 2059167 - 2059124
Alignment:
766 aaattctttgaacgagagattctatcatttgactttgaacttcctt 811  Q
    |||||||||||||||||  |||||||||||| ||||||||||||||    
2059167 aaattctttgaacgaga--ttctatcatttgcctttgaacttcctt 2059124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #160
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 9588611 - 9588561
Alignment:
493 gctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||| |||| | |||||||||||||| |||||||||||||||||    
9588611 gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagt 9588561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #161
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 491 - 541
Target Start/End: Complemental strand, 17070864 - 17070814
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    ||||||||||||||||||  ||||| |||||||| |||||||| |||||||    
17070864 aggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag 17070814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #162
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 28213446 - 28213480
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||| |||||||||||||||||||||||||||||    
28213446 ttttggtccctgcaaatatgcctcgttttggtttt 28213480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #163
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 3851330 - 3851273
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||  ||||||| ||||||||| ||||||| |||||    
3851330 aggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgt 3851273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #164
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 536
Target Start/End: Original strand, 4736204 - 4736249
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggt 536  Q
    ||||||||||||||||||| ||  |||||||||| |||||||||||    
4736204 aggctaaaatatggttttggtctttgcaaatatgtctcgttttggt 4736249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #165
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 505 - 542
Target Start/End: Original strand, 31602221 - 31602258
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||| |||||||||||||| |||||||||||||||||    
31602221 ttttggtccctgcaaatatgtctcgttttggttttagt 31602258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 62; Significance: 2e-26; HSPs: 212)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 592 - 811
Target Start/End: Original strand, 6486478 - 6486701
Alignment:
592 cgttttacattccttggtttcttcttcctc---attagagattggtggtggtgagtaggtgacttcttttgcggagaggaagagagacgaaggagt---- 684  Q
    |||||||||||||| |||||||||||| ||   ||||||| ||||||||||||||| |||||||||||||| ||||||| |||||||| |||||||        
6486478 cgttttacattcctaggtttcttcttcttcttcattagaggttggtggtggtgagtcggtgacttcttttgtggagagggagagagacaaaggagtatgc 6486577  T
685 atggtgtggg-gtgtatgtgtgtctgagtgagagagagtggtgcggtgtgttagttttccaacttttggcattttttcgtcgaaattctttgaacgagag 783  Q
    |||||||||| || | ||||||| ||||||| ||||| | ||| |||||||| |||| |   |||||||||||||||   | |||||||||||||   ||    
6486578 atggtgtgggtgtatttgtgtgtgtgagtgacagagaatagtgtggtgtgtt-gtttccttgcttttggcatttttt-tcccaaattctttgaac--aag 6486673  T
784 attctatcatttgactttgaacttcctt 811  Q
    ||||||| ||||| ||||||| ||||||    
6486674 attctataatttgcctttgaatttcctt 6486701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 13530715 - 13530617
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
13530715 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 13530617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 24774043 - 24774141
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         |||||||||||||||| ||||||||||||||    
24774043 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttattgtttttggtccttgcaaaatattttg 24774141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 25423918 - 25424020
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||||||    
25423918 ttttaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 25424017  T
586 ttg 588  Q
    |||    
25424018 ttg 25424020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 43231391 - 43231293
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
43231391 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 43231293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 485 - 588
Target Start/End: Complemental strand, 23779232 - 23779129
Alignment:
485 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat 584  Q
    |||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||||         || ||||||||||||||||||||||||    
23779232 gttttaaggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgtcaattttttttgttgtttttggtccctgcaaaatat 23779133  T
585 tttg 588  Q
    ||||    
23779132 tttg 23779129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 29499180 - 29499278
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
29499180 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 29499278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 30046794 - 30046696
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
30046794 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 30046696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 30061135 - 30061037
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
30061135 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 30061037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 35464012 - 35464114
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||||||    
35464012 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 35464111  T
586 ttg 588  Q
    |||    
35464112 ttg 35464114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 13631227 - 13631324
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
13631227 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 13631324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 14487801 - 14487898
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||         || ||||||||||||||||||||||||||||    
14487801 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 14487898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 23245596 - 23245499
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||         || |||||||||||||| |||||||||||||    
23245596 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttg 23245499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 53916048 - 53915951
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||          || ||||||||||||||||||||||||||||    
53916048 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 53915951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 46115414 - 46115510
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||| ||||||||||||||    
46115414 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg 46115510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 46128548 - 46128644
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||| ||||||||||||||    
46128548 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg 46128644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 580
Target Start/End: Complemental strand, 2322434 - 2322344
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||    
2322434 aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgtaaattgtttttgttgtttttggtccctgcaaa 2322344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 45505896 - 45505838
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
45505896 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 45505838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 31560329 - 31560386
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
31560329 aaggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg 31560386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 31560695 - 31560599
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||         || ||||||||||||||||||||||||||||    
31560695 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 31560599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 31811920 - 31811981
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||||||||||||||||||  |||||||||||||||| |||||    
31811920 tttaaggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgt 31811981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 32365093 - 32365150
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
32365093 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 32365150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 488 - 588
Target Start/End: Original strand, 50753918 - 50754018
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||| ||||||||||||||| |||||||||||||  || ||||||||||||||||||||         || |||||||||||||||||||||||||||    
50753918 ttaaggttaaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgtaaatttcttttgttgtttttggtccctgcaaaatatttt 50754017  T
588 g 588  Q
    |    
50754018 g 50754018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 493 - 588
Target Start/End: Original strand, 2322094 - 2322189
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||         || |||||||||||||||||| |||||||||    
2322094 gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgtaaaaaatttttgttgtttttggtccctgcagaatattttg 2322189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 18205150 - 18205206
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
18205150 ttttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 18205206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 26412189 - 26412245
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||    
26412189 aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 26412245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 41324890 - 41324834
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||    
41324890 ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgt 41324834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 44925483 - 44925535
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||    
44925483 aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 44925535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 494 - 588
Target Start/End: Complemental strand, 19903653 - 19903559
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||| |||||||||||||| ||||||||||||||||| | |||         || ||||||||||||||||||||||||||||    
19903653 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaaatattttg 19903559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 23245231 - 23245286
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
23245231 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23245286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 580
Target Start/End: Complemental strand, 25424314 - 25424224
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||    
25424314 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 25424224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 35464382 - 35464327
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
35464382 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35464327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 42848025 - 42848123
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| | |||||||||||| ||||||||||||||||| |||||         || |||||||||||||| |||||||||||||    
42848025 aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttg 42848123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 42848391 - 42848336
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
42848391 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 42848336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 52017502 - 52017561
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
52017502 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 52017561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 52017873 - 52017814
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
52017873 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 52017814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 54903478 - 54903419
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||    
54903478 taaggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt 54903419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 2180214 - 2180276
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||||  |||||||||||||||||| ||||||||||||| |||||    
2180214 ttttaaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt 2180276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 5827975 - 5827917
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
5827975 aaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgt 5827917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 13064467 - 13064409
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
13064467 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 13064409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 13074126 - 13074029
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| ||||||||||||| |||||||||||||||||| | |||         || ||||||||| ||||||||||||||||||    
13074126 aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgtaatttttttttgttgtttttgatccctgcaaaatattttg 13074029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 13631602 - 13631544
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
13631602 taaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg 13631544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 16712693 - 16712635
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
16712693 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 16712635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 544
Target Start/End: Original strand, 23778962 - 23779016
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||    
23778962 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc 23779016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 26314334 - 26314276
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||    
26314334 aaggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgt 26314276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 29499549 - 29499491
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
29499549 taaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 29499491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 32208538 - 32208592
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
32208538 ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 32208592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 32208905 - 32208851
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||| |||||||    
32208905 ttaaggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagt 32208851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 42823775 - 42823872
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||| |||||||||||||||||||    
42823775 aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgtaaattttttttgttgtttttagtccctgcaaaatattttg 42823872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Complemental strand, 6827880 - 6827819
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| ||||  |||||||||||||||||||||||||||||||| ||||    
6827880 ttttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 6827819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 14791808 - 14791751
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
14791808 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 14791751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 35415633 - 35415537
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| ||||          || |||||||||||||||||||||| |||||    
35415633 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttg 35415537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 41345851 - 41345908
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
41345851 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 41345908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 43231086 - 43231143
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
43231086 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 43231143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 45505595 - 45505656
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||  ||||||||||||||||| |||||||||||||| |||||    
45505595 tttaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 45505656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 539
Target Start/End: Original strand, 4211560 - 4211608
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||    
4211560 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 4211608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 13073759 - 13073815
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
13073759 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 13073815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 35763646 - 35763702
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
35763646 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 35763702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 487 - 539
Target Start/End: Original strand, 46292387 - 46292439
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||| |||||||||||||||||| |||||||||||||||||||||||||||||    
46292387 tttatggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 46292439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 489 - 588
Target Start/End: Original strand, 47022737 - 47022836
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||| ||||||||||||||| ||| |||||||||| ||||||||||||||||| ||| |         || ||||||||||||||||||||||||||||    
47022737 taaggataaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatattttg 47022836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 47023106 - 47023050
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||||||||||||||||  |||||||||||||||| ||||    
47023106 aggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg 47023050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 493 - 580
Target Start/End: Complemental strand, 51763201 - 51763114
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||| |||||| |||||||||||||||||| |||||||||||||||||||         || ||||||||||||||||||||    
51763201 gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgtaaattttttttgttgtttttggtccctgcaaa 51763114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 53308068 - 53307973
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||| | ||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
53308068 ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatattttg 53307973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 53717174 - 53717118
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
53717174 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 53717118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 53915682 - 53915738
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||    
53915682 aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 53915738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 6353637 - 6353582
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||    
6353637 gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt 6353582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 582
Target Start/End: Complemental strand, 19321859 - 19321769
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat 582  Q
    |||||||||||||||||| ||||||||||||||  |||||||||||||||| |||||         || ||||||||||||||||||||||    
19321859 ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaat 19321769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 20291985 - 20292036
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| ||||| ||||||||||||||||||||||||||||||||    
20291985 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt 20292036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 487 - 542
Target Start/End: Original strand, 22099538 - 22099593
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| |||||||||||||||||  ||||||||||||||||||||||||||||||||    
22099538 tttatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 22099593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 26412584 - 26412529
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
26412584 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 26412529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 29420538 - 29420487
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||||||    
29420538 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 29420487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 497 - 587
Target Start/End: Complemental strand, 47532667 - 47532577
Alignment:
497 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    ||||||||||||| ||| |||||||||| |||||||||||||||||||||||         || || ||||||||||||||||||||||||    
47532667 aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaattgttatttttggtccctgcaaaatatttt 47532577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 51762868 - 51762966
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||| ||| || |||||||||||| || ||||||||||||| |||||         || ||||||||||||||||||||||||||||    
51762868 aaggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 51762966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 2034857 - 2034799
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||| ||||||||||||||||||||||||||| |||||    
2034857 aaggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgt 2034799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 8904884 - 8904934
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||| |||||| ||||||||||||||||||||||||||||||    
8904884 aaggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta 8904934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 13064153 - 13064215
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||||||  |||||||||||||||||||||||| ||||||| |||||    
13064153 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt 13064215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 580
Target Start/End: Complemental strand, 14488188 - 14488099
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||         || ||||||||||||||||||||    
14488188 aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 14488099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 18205521 - 18205467
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
18205521 ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 18205467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 22099916 - 22099862
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||  |||||||||||||| |||||||||||||||||    
22099916 ttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 22099862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 29463915 - 29463857
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||| || |||||    
29463915 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgt 29463857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 31812215 - 31812157
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| | |||||||||||| ||||||||||||||||| |||||    
31812215 aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt 31812157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 32365485 - 32365427
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
32365485 aaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt 32365427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 35119290 - 35119348
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||||||||||||  ||||||||||||||| |||||    
35119290 aaggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgt 35119348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 36054152 - 36054094
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||||| |||||||||||||||||| ||||||||||||| |||||    
36054152 aaggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgt 36054094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 36701994 - 36702056
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
36701994 ttttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 36702056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 38054544 - 38054602
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
38054544 aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 38054602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 45593592 - 45593530
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||||||  || ||||||||||| |||||||||||||||||||||||    
45593592 tttttaggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgt 45593530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 51738136 - 51738233
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| ||||| |||||||| ||||||||||||||| | |||||         || || |||||||||||||||||||||||||    
51738136 aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgtaaaaaaaaattgttctttttggtccctgcaaaatattttg 51738233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 55072387 - 55072445
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
55072387 aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 55072445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 6827543 - 6827596
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||  ||| ||||||||||||||||||||||||||||    
6827543 taaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 6827596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 11693122 - 11693065
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||||    
11693122 aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgt 11693065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 12152494 - 12152437
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||| || |||||    
12152494 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgt 12152437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 12791975 - 12791918
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
12791975 aggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgt 12791918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 13479612 - 13479555
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
13479612 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 13479555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 51545626 - 51545679
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||  ||||||||||||| ||||||||||||||||||    
51545626 taaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt 51545679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 51545966 - 51545913
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
51545966 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 51545913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 487 - 540
Target Start/End: Original strand, 52543417 - 52543470
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||||||| ||| |||||||||| |||||||||||||||    
52543417 tttaaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 52543470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 123533 - 123589
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||||||| ||||||||||||| ||||    
123533 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 123589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 5052586 - 5052534
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||| |||||||||||  ||||||||||||||||||||||||||||||||    
5052586 aaggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagt 5052534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 5827655 - 5827711
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||    
5827655 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt 5827711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 488 - 548
Target Start/End: Original strand, 8760600 - 8760660
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| |||||  |||||||||||||| ||||||||||||||||| |||||    
8760600 ttaaggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgt 8760660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 323 - 380
Target Start/End: Original strand, 9075166 - 9075225
Alignment:
323 tataaagtaagaattttaaca--gtcttgaaccagttcagattatataatccaaacattt 380  Q
    ||||||||| |||||||||||  ||||||||| |||||||||||||||||||||||||||    
9075166 tataaagtatgaattttaacacagtcttgaacgagttcagattatataatccaaacattt 9075225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 9289265 - 9289321
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
9289265 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 9289321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 13530378 - 13530434
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||    
13530378 aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg 13530434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 13764613 - 13764669
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||| ||| |||||    
13764613 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgt 13764669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
15555506 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 15555558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 494 - 542
Target Start/End: Original strand, 16712331 - 16712379
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| ||||||||||||||||||||||||||| |||||    
16712331 ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagt 16712379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 24474965 - 24474913
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||    
24474965 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 24474913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 26313988 - 26314044
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||||||||||||||   ||||||||||||||| |||||    
26313988 ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgt 26314044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 27008084 - 27008140
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||| |||||  |||||||||||||||||||||||||||||||| |||||    
27008084 ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt 27008140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 484 - 540
Target Start/End: Complemental strand, 28449222 - 28449166
Alignment:
484 agttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||||||||||| ||| |||||||||| ||||||||| |||||    
28449222 agttttaaggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta 28449166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 28809182 - 28809130
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
28809182 aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt 28809130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 29380912 - 29380860
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||    
29380912 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 29380860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| |||||||||||||||||||||||| ||||||| ||||    
30060772 taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg 30060824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 34361801 - 34361853
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||    
34361801 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 34361853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 41619902 - 41619954
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
41619902 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 41619954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 46088061 - 46088005
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
46088061 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 46088005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 46292653 - 46292601
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||||||| |||||||||||||    
46292653 aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt 46292601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 51709029 - 51708977
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||||||| |||||||||||||    
51709029 aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt 51708977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 54208827 - 54208775
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||| |||||||||||||| |||||||||||||||||    
54208827 aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 54208775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 497 - 548
Target Start/End: Original strand, 2034544 - 2034595
Alignment:
497 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||| ||||| |||||||||||||||||||||||||||||||| |||||    
2034544 aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt 2034595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 9445946 - 9446005
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| |||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
9445946 taagactaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 9446005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 11285504 - 11285559
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
11285504 gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 11285559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 14791502 - 14791549
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| |||||||||||||||||| |||||||||||||    
14791502 taaaatatggttttggtccctgcaaatatgcctcattttggttttagt 14791549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 540
Target Start/End: Complemental strand, 20144734 - 20144683
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||||| | | ||||||||||||||||||||||||||    
20144734 taaggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta 20144683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 29463610 - 29463665
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  | |||||||||||||||||||||||||||| ||||||    
29463610 ggctaaaatatggttttatttcctgcaaatatgcctcgttttggttttaattcctg 29463665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 31182506 - 31182409
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| || |||||||||||| ||||||||||||| ||| |||||         || ||| ||||||||||||||||||||||||    
31182506 aaggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgtaaatttttgtttttg-ttttggtccctgcaaaatattttg 31182409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 36050289 - 36050344
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| |||| ||||||||| ||||||||||||||||| |||||    
36050289 gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgt 36050344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 37557194 - 37557139
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| ||||||||||||| |||||||||| ||||||| |||||    
37557194 gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgt 37557139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 44925844 - 44925789
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| || | ||||||||||||||||||||||||||| |||||    
44925844 gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgt 44925789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 50714240 - 50714295
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||||||| ||||||||||||| ||||    
50714240 ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 50714295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 50714565 - 50714510
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
50714565 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 50714510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 51708692 - 51708743
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
51708692 aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt 51708743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 54903109 - 54903207
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||| ||||||||||||||||||||| ||||||||| ||||||| |||||| |||||||         || ||||||||| |||| |||||||||||||    
54903109 aaggttaaaatatggttttgatccctacaaatatgcatcgttttagttttaattcctgtaaaacaaatttgttgtttttgatccccgcaaaatattttg 54903207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 8760783 - 8760725
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||| |||||||||| ||||||||||||||||| |||||    
8760783 aaggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgt 8760725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 18136115 - 18136057
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||  ||| |||||| |||||||||||||||||||||||||| |||||    
18136115 aaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt 18136057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 495 - 541
Target Start/End: Original strand, 20144423 - 20144469
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    ||||||||||||||| ||||||||||||||||||||||| |||||||    
20144423 taaaatatggttttggtccctgcaaatatgcctcgttttagttttag 20144469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 27427869 - 27427926
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| | |||||||||||||| ||||||||||||||||| ||||    
27427869 taaggctaaaatatggtttag-tccctgcaaatatggctcgttttggttttagtccctg 27427926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 35763956 - 35763859
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||| ||||  |||||||| ||||||||||||||||||||||| ||||          || |||||||||||||||||||||| |||||    
35763956 aggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggtaatttttttttttgtttttggtccctgcaaaattttttg 35763859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 41620259 - 41620201
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||||| |||||||| |||||||||||||||| ||||    
41620259 taaggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg 41620201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 45474600 - 45474546
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||  ||||||||||||||| ||| ||||||||||||    
45474600 ttaaggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagt 45474546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 49123323 - 49123265
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||  ||| |||||| |||||||||||||||||||||||||| |||||    
49123323 aaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt 49123265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 52442094 - 52442036
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||| |||||||||| ||||||||||||||||| |||||    
52442094 aaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt 52442036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 5882551 - 5882607
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
5882551 aggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgt 5882607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 129 - 214
Target Start/End: Original strand, 9075000 - 9075085
Alignment:
129 tagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttata 214  Q
    ||||||||||||||||||||||  | | |||| |||| ||||||||||||||||| ||||||||| || | |||  ||||||||||    
9075000 tagtttggtgttcagatcaatgatcaaagtgtacatggttatttggtgtggtttacaacatatgaaaaaacacacactaatttata 9075085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 12152153 - 12152210
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||||||| |||||||  |||||||| |||||    
12152153 aggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgt 12152210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 489 - 542
Target Start/End: Complemental strand, 13764810 - 13764757
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||| |||||| |||||||  ||||||||||||||||    
13764810 taaggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagt 13764757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #148
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 485 - 542
Target Start/End: Original strand, 14594199 - 14594256
Alignment:
485 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||| ||||||||||||||||||| |||||||||||||| |||  ||||||||||||    
14594199 gtttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagt 14594256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #149
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 19903260 - 19903317
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||||||||||||||||||| ||| ||||| ||||||| |||||    
19903260 aggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgt 19903317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #150
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 46115781 - 46115724
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||| | ||||||||||||||||| ||||    
46115781 aaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg 46115724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #151
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 46128915 - 46128858
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||| | ||||||||||||||||| ||||    
46128915 aaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg 46128858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #152
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 47136170 - 47136121
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||| |||||||||||||| ||| |||||||||||||    
47136170 gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 47136121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #153
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 52430101 - 52430044
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| |||||||| |||||||| |||||    
52430101 aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt 52430044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #154
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 52441762 - 52441819
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
52441762 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 52441819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #155
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 540
Target Start/End: Complemental strand, 55072709 - 55072664
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||    
55072709 taaaatatggttttagtccctgcaaatatgcctcgttttggtttta 55072664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #156
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 5202929 - 5202977
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcg-ttttggttttagt 542  Q
    ||||||||||||||| ||||||||||||||||||| |||||||||||||    
5202929 taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagt 5202977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #157
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 8191391 - 8191335
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||| ||||| ||| |||||    
8191391 ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt 8191335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #158
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 9289640 - 9289584
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||| ||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
9289640 aggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 9289584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #159
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 19321569 - 19321625
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||| ||||| |||||| ||| ||||||||||||||||||||| ||||    
19321569 aggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg 19321625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #160
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 35415298 - 35415354
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||| |||||||| |||||||||||||||| ||||    
35415298 aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg 35415354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #161
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 588
Target Start/End: Complemental strand, 35420701 - 35420606
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||| ||| |||||||||| |||| |||||||||||| |||||          || ||||||||||||||||||||||||||||    
35420701 ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgtaattttttttttgttgtttttggtccctgcaaaatattttg 35420606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #162
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 43368777 - 43368721
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| || || |||||||||  ||||||||||||||||||||||    
43368777 ggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctgt 43368721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #163
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 539
Target Start/End: Complemental strand, 51738412 - 51738364
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||||||||||||||||| ||| |||||||||||||||||||| ||||    
51738412 aggctaaaatatggttttggtccatgcaaatatgcctcgttttgatttt 51738364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #164
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 511 - 590
Target Start/End: Original strand, 54208480 - 54208559
Alignment:
511 tccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttgat 590  Q
    |||||||||||||||||| ||||||||||||| |||||         || |||||||||||| |||||||||||||||||    
54208480 tccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtctctgcaaaatattttgat 54208559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #165
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 55482468 - 55482412
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||  ||||| |||||||||||||||||||||||||| |||||    
55482468 ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgt 55482412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #166
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 11692761 - 11692812
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||| |||||||| |||||||||||||||| ||||||| |||||||    
11692761 aggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagt 11692812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #167
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 540
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||  |||||||||||||| |||||||||||||||    
13479273 gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 13479320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #168
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 22584286 - 22584337
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||| |||||||||| |||||||||||||||||    
22584286 aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 22584337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #169
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||| ||||| |||||| ||||||| ||||||||||||||||| ||||    
25358540 ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg 25358485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #170
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 497 - 548
Target Start/End: Complemental strand, 27008401 - 27008350
Alignment:
497 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||  || ||||||||||||||||||||||||||||| |||||    
27008401 aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt 27008350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #171
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 28448833 - 28448884
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||| | ||||||||||||||||||||||||||    
28448833 aggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagt 28448884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #172
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 494 - 588
Target Start/End: Original strand, 30564835 - 30564929
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||  ||||||||||||||  | |||||||||||||| |||||         || ||||||||| ||||||||||||||||||    
30564835 ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgtagatttttgtttttgtttttgatccctgcaaaatattttg 30564929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #173
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 538
Target Start/End: Complemental strand, 35119612 - 35119565
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    ||||||||||||||||||| || ||||||||||| |||||||||||||    
35119612 aggctaaaatatggttttggtcactgcaaatatgtctcgttttggttt 35119565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #174
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 36702362 - 36702307
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||  | |||||| ||||||||||||||||||||||| |||||    
36702362 gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgt 36702307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #175
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 41346219 - 41346168
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| ||| |||||||||||||    
41346219 aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagt 41346168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #176
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 487 - 542
Target Start/End: Complemental strand, 41921089 - 41921034
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||||   |||||||||||||  ||||||||||||||||    
41921089 tttaaggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagt 41921034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #177
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 53716920 - 53716971
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| || ||||||||||||||    
53716920 aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt 53716971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #178
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 4279335 - 4279285
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||| ||||  |||||||||||||| |||||||||||||||||    
4279335 ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagt 4279285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #179
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 35420393 - 35420447
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||| |||| |||||||||| | |||||||||||||| |||||    
35420393 ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgt 35420447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #180
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 161 - 243
Target Start/End: Original strand, 41967707 - 41967789
Alignment:
161 ccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttatagaagattatgtgtgtcgtggatcacaaaa 243  Q
    ||||||||||||||||||||||| ||||||||| ||||  ||  |||||||||||||| || | || |||||| | |||||||    
41967707 ccatgattatttggtgtggtttacaacatatgaaaacaagcacactaatttatagaagtttctttgcgtcgtgtaccacaaaa 41967789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #181
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 42824091 - 42824041
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |||||||||||||| || |||||| |||||||    
42824091 ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagt 42824041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #182
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 43368467 - 43368521
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  ||||||||||||||  |||||||||||||||| |||||    
43368467 ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt 43368521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #183
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 497 - 542
Target Start/End: Complemental strand, 123893 - 123848
Alignment:
497 aaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||  |||||||||||||||||| |||||||||||||    
123893 aaatatggttttagtccctgcaaatatgcctcattttggttttagt 123848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #184
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 4279021 - 4279078
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||   ||||||||||||  ||||||||||||||||| |||||    
4279021 aggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgt 4279078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #185
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 5797484 - 5797537
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||| ||||| || ||||||||||| ||||||||||||||||| |||||    
5797484 taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgt 5797537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #186
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 540
Target Start/End: Complemental strand, 5797817 - 5797772
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||| ||||| |||||||| |||||||||||||||    
5797817 taaaatatggttttggtccctacaaatatgtctcgttttggtttta 5797772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #187
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 15555637 - 15555588
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||| |||||  |||||||||||||| |||||||||||||||||    
15555637 gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt 15555588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #188
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 22584608 - 22584551
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||| |||||||  || |||||||||||| |||||||||||||||| |||||    
22584608 aggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgt 22584551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #189
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 539
Target Start/End: Original strand, 29380666 - 29380715
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||||||||||| |||||  |||||||||||||| ||||||||||||||    
29380666 aaggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt 29380715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #190
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 34355284 - 34355227
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||  ||||||| ||||||||||||||||| |||||    
34355284 aggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgt 34355227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #191
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 45593227 - 45593284
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| |||||  ||||| ||||||||||||||||||| |||||| |||||    
45593227 aggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgt 45593284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #192
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 8905234 - 8905186
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||| |||||| ||||||||||| ||||| |||||    
8905234 ggctaaaatatggttttggtccctgtaaatatgcctcattttgatttta 8905186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #193
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 28809011 - 28809067
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||| ||||||||||  |||||||||||||||| |||||    
28809011 ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgt 28809067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #194
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 213
Target Start/End: Complemental strand, 29551874 - 29551790
Alignment:
129 tagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttat 213  Q
    |||||| |||||| |||||||| |||| |||||||||||| |||||||| |||||   | ||||| ||||||||  |||||||||    
29551874 tagtttagtgttcggatcaatgaccgaagtgtccatgattttttggtgtagtttactccttatgaaaacatacacactaatttat 29551790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #195
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 543
Target Start/End: Original strand, 31370803 - 31370855
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 543  Q
    ||||||||||||||||||  |  |||| |||||||||||||||||||||||||    
31370803 aggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagtt 31370855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #196
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 540
Target Start/End: Original strand, 7639897 - 7639944
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||| ||||| |||||||| || ||||||||||||    
7639897 gctaaaatatggttttggtccctacaaatatgtcttgttttggtttta 7639944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #197
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 24474599 - 24474649
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||| ||||||||||| ||||||||||||||||    
24474599 aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagt 24474649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #198
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 2180572 - 2180522
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||| |||||  |||||||||||||| | |||||||||||||||    
2180572 ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagt 2180522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #199
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 490 - 524
Target Start/End: Original strand, 9836830 - 9836864
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatg 524  Q
    |||||||||||||||||||||||| ||||||||||    
9836830 aaggctaaaatatggttttgatccttgcaaatatg 9836864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #200
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 18831176 - 18831122
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  |||||| ||||||| || |||||||||||||| |||||    
18831176 ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgt 18831122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #201
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 489 - 523
Target Start/End: Complemental strand, 33137290 - 33137256
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatat 523  Q
    ||||||||||||||| |||||||||||||||||||    
33137290 taaggctaaaatatgtttttgatccctgcaaatat 33137256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #202
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 36050359 - 36050393
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||| |||||||||||||||||||||||||||||    
36050359 ttttggtccctgcaaatatgcctcgttttggtttt 36050393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #203
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||| |||||  | |||||||||||| |||||||||||||||||    
47274230 ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 47274180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #204
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 494 - 540
Target Start/End: Complemental strand, 52543725 - 52543679
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||| ||||| | | ||||||||||||||||||||||||||    
52543725 ctaaaatatgattttggttcttgcaaatatgcctcgttttggtttta 52543679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #205
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 55805088 - 55805038
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||| |||||| | | ||||||||||||| ||||||||||||||    
55805088 ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagt 55805038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #206
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 486 - 523
Target Start/End: Original strand, 3879080 - 3879117
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatat 523  Q
    |||| ||||||||||||| |||||||||||||||||||    
3879080 tttttaggctaaaatatgcttttgatccctgcaaatat 3879117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #207
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 493 - 538
Target Start/End: Original strand, 25358213 - 25358258
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    ||||||||||| |||| |||| ||||||||||| ||||||||||||    
25358213 gctaaaatatgattttaatccatgcaaatatgcttcgttttggttt 25358258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #208
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 30890832 - 30890881
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| ||||||||||||||||| ||  |||| ||||||||    
30890832 gctaaaatatggttatgatccctgcaaatatgtcttattttagttttagt 30890881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #209
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 524
Target Start/End: Original strand, 33134890 - 33134923
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatg 524  Q
    ||||||||||||| ||||||||||||||||||||    
33134890 aggctaaaatatgtttttgatccctgcaaatatg 33134923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #210
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 37556840 - 37556897
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||   || ||||||||| ||||| |||||||||||| |||||    
37556840 aggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgt 37556897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #211
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 429 - 470
Target Start/End: Complemental strand, 41508464 - 41508423
Alignment:
429 ggttacttgttcagcaagagtaacttattgaacatgtttttc 470  Q
    ||||||||| ||||||||||||||| || |||||||||||||    
41508464 ggttacttgctcagcaagagtaactcatggaacatgtttttc 41508423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #212
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 50754257 - 50754200
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||| ||||||| ||   |||||| ||||||||| |||||    
50754257 aggctaaaatatggttttgatcactgcaaacatatatcgtttaggttttagtccctgt 50754200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 60; Significance: 4e-25; HSPs: 175)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 10872913 - 10873011
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||         || |||||||| |||||||||||||||||||    
10872913 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaaaaataatttgttgtttttagtccctgcaaaatattttg 10873011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 4474049 - 4473988
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
4474049 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt 4473988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 488 - 588
Target Start/End: Original strand, 28346390 - 28346490
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || |||||||||||||||||||||||||||    
28346390 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatatttt 28346489  T
588 g 588  Q
    |    
28346490 g 28346490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 489 - 588
Target Start/End: Complemental strand, 7420593 - 7420494
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
7420593 taaggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 7420494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 8298977 - 8298879
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
8298977 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 8298879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 10337113 - 10337215
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||||||    
10337113 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 10337212  T
586 ttg 588  Q
    |||    
10337213 ttg 10337215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 37536084 - 37536182
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
37536084 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattttg 37536182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 4710221 - 4710124
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
4710221 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 4710124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 6469279 - 6469376
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||| |||  ||||||||||||||||||||||||||||||||||||||         || ||||||||||||||||||||||||||||    
6469279 aggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 6469376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 9496340 - 9496437
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||          || ||||||||||||||||||||||||||||    
9496340 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 9496437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 34963664 - 34963568
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          |||||||||||||||||||||||||||||||    
34963664 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttattgtttttggtccctgcaaaatattttg 34963568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 585
Target Start/End: Original strand, 11976371 - 11976465
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
11976371 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatatt 11976465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 32725905 - 32726003
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
32725905 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 32726003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 3511905 - 3512002
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
3511905 aggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 3512002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 7326421 - 7326324
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||          ||||||||||||||||||| |||||||||||    
7326421 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaatttttttttattgtttttggtccctgtaaaatattttg 7326324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 14495067 - 14495125
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
14495067 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 14495125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 24187563 - 24187625
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||||    
24187563 ttttaaggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgt 24187625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 34963297 - 34963355
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
34963297 taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 34963355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 35097327 - 35097424
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
35097327 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 35097424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 35346999 - 35346902
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
35346999 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 35346902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 25600229 - 25600286
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||    
25600229 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgt 25600286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 10776499 - 10776443
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
10776499 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 10776443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 11019858 - 11019802
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
11019858 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 11019802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 14239084 - 14239024
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
14239084 ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 14239024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 493 - 588
Target Start/End: Complemental strand, 24090487 - 24090392
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||  ||||         || ||||||||||||||| ||||||||||||    
24090487 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaattgttgtttttggtccctacaaaatattttg 24090392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 28346759 - 28346703
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
28346759 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 28346703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 32726272 - 32726216
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
32726272 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 32726216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 2728230 - 2728328
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||| ||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
2728230 aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 2728328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 2728597 - 2728542
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
2728597 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 2728542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 484 - 547
Target Start/End: Complemental strand, 9496731 - 9496668
Alignment:
484 agttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
9496731 agttctaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 9496668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 10540785 - 10540726
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||    
10540785 taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt 10540726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 11019516 - 11019575
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
11019516 ttaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 11019575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 16789072 - 16789131
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
16789072 taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 16789131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 580
Target Start/End: Original strand, 20984144 - 20984234
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||    
20984144 aaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 20984234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 20984512 - 20984414
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||||         || |||||||||||||| |||||||||||||    
20984512 aaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttg 20984414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 27341593 - 27341495
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||          | || |||||||||||||||||||||||||    
27341593 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttatttttggtccctgcaaaatattttg 27341495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 35097692 - 35097637
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
35097692 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 35097637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 582
Target Start/End: Complemental strand, 42133154 - 42133064
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat 582  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||    
42133154 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaat 42133064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 2811785 - 2811731
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||| |||||||||||||||||||||||||||||| |||||||||||||||||    
2811785 ttaaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt 2811731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 5357422 - 5357519
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||| |         || ||||||||||| ||||||||||||||||    
5357422 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctataaaaaaattttgttgtttttggttcctgcaaaatattttg 5357519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 580
Target Start/End: Original strand, 13154885 - 13154974
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||    
13154885 aggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgtaattttcttttgttgtttttggtccctgcaaa 13154974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 495 - 588
Target Start/End: Complemental strand, 13796593 - 13796500
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||| |||||||||||||||| ||| ||||||||||||| |||||         || ||||||||||||||||||||||||||||    
13796593 taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttg 13796500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 16789375 - 16789313
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||| |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
16789375 ttttatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 16789313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 20277690 - 20277748
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||    
20277690 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt 20277748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 20278058 - 20277961
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||| ||||||||||||||||||||||| | |||         || ||||||||||||||| ||||||||||||    
20278058 aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaatttttttttgttgtttttggtccctccaaaatattttg 20277961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 21064317 - 21064375
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||    
21064317 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgt 21064375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 21064685 - 21064588
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||| ||||||||||||||||||||||| | |||         || ||||||||||||||| ||||||||||||    
21064685 aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaatttttttttgttgtttttggtccctccaaaatattttg 21064588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 22917561 - 22917619
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
22917561 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 22917619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 25131109 - 25131167
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
25131109 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 25131167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 40066495 - 40066553
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||||||||||| ||||||||||||||    
40066495 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgt 40066553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 43477161 - 43477219
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
43477161 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 43477219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 539
Target Start/End: Complemental strand, 3680803 - 3680754
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||    
3680803 aaggctaaaatatgattttgatccctgcaaatatgcctcgttttggtttt 3680754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 7420228 - 7420285
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
7420228 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 7420285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 580
Target Start/End: Original strand, 8298587 - 8298675
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||    
8298587 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 8298675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 582
Target Start/End: Original strand, 44997929 - 44998021
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat 582  Q
    |||||||||||||| ||||| |||||||||||||||||||||||| ||||| |||||||         || ||||||||||||||||||||||    
44997929 aaggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgtaaattttttttgttgtttttggtccctgcaaaat 44998021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 1525807 - 1525859
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
1525807 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 1525859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 3512267 - 3512211
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
3512267 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 3512211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 4621354 - 4621298
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||    
4621354 ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgt 4621298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 7186004 - 7185948
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
7186004 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 7185948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 7326085 - 7326141
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||    
7326085 aggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg 7326141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 10337450 - 10337394
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||    
10337450 aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg 10337394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 544
Target Start/End: Complemental strand, 13232562 - 13232510
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||||||||||||| |||||||||||||||||| |||||||||||||||    
13232562 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttc 13232510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 14489073 - 14489017
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
14489073 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 14489017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 487 - 547
Target Start/End: Complemental strand, 16644049 - 16643989
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
16644049 tttaaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg 16643989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 19494118 - 19494174
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||||||||    
19494118 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 19494174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 19494414 - 19494358
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
19494414 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 19494358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 32418316 - 32418368
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
32418316 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 32418368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 1778564 - 1778619
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
1778564 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1778619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 586
Target Start/End: Complemental strand, 7272751 - 7272657
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt 586  Q
    |||||||||||||||||   ||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||| ||||    
7272751 ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgtaaacaaaattttttgtttttggtccctgcaaaaaattt 7272657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 9175010 - 9175108
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||| ||||| ||| |||||||||| ||||||||||||||||| |||||         || |||||||||||||| |||||||||||||    
9175010 aaggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtcccagcaaaatattttg 9175108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 10873280 - 10873225
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| || ||||||||||||||||||||||||||||| ||||    
10873280 ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg 10873225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 494 - 588
Target Start/End: Original strand, 13779151 - 13779245
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||| | |||||          | |||||||||||| |||||||||||||||    
13779151 ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgtaaaaaaaaaatgttgtttttggtctctgcaaaatattttg 13779245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 25702506 - 25702608
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||| |||||| ||||||||||||||||  ||||||| |||||         || ||||||||||||| |||||||||||    
25702506 tttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgtaagaaaaaattgttgtttttggtccatgcaaaatatt 25702605  T
586 ttg 588  Q
    |||    
25702606 ttg 25702608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 35346629 - 35346684
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
35346629 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 35346684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 37536419 - 37536364
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
37536419 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 37536364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 13155252 - 13155155
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||  | |||||||||||| ||||||||||||||| | |||||         |||||||||||| ||||||||||||||||||    
13155252 aggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaattattgtttttgatccctgcaaaatattttg 13155155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 14238749 - 14238807
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
14238749 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 14238807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 580
Target Start/End: Complemental strand, 24815069 - 24814980
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||||  ||||||||||||| ||| ||||||||||||| |||||         |||||||||||||||||||||||    
24815069 aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaa 24814980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 484 - 542
Target Start/End: Complemental strand, 24955018 - 24954960
Alignment:
484 agttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||| ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
24955018 agtttttaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagt 24954960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 487 - 588
Target Start/End: Original strand, 28323844 - 28323944
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt 586  Q
    |||||||||||||||||||| |  ||||||||||||||| |||||||||||||||| ||| |         || ||||||||||||||||||||||||||    
28323844 tttaaggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct-ttaaaaaaaattgttgtttttggtccctgcaaaatattt 28323942  T
587 tg 588  Q
    ||    
28323943 tg 28323944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 495 - 588
Target Start/End: Complemental strand, 28497616 - 28497523
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||| ||||| |||||||||||||||||||||||||||||||| |||||          | |||||||||||||||| |||||||||||    
28497616 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaatttttatgttgtttttggtccctgaaaaatattttg 28497523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 29488112 - 29488054
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
29488112 aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt 29488054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 38930299 - 38930357
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||||| ||||||| ||||||||||||||||||||||    
38930299 taaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg 38930357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 4017302 - 4017245
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  ||| |||||||||||||||||||||||||||| ||||    
4017302 aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 4017245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 13232201 - 13232254
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
13232201 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 13232254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 17073806 - 17073863
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||    
17073806 aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt 17073863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 17574464 - 17574407
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||    
17574464 aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt 17574407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 27117752 - 27117809
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||||||| ||||||||| ||||||| |||||    
27117752 aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgt 27117809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 539
Target Start/End: Complemental strand, 27117978 - 27117929
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||    
27117978 aaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttt 27117929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 29158353 - 29158410
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
29158353 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 29158410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 29992301 - 29992244
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||| ||||||||||||| |||||||||||||||||||||||| ||||||| |||||    
29992301 aggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgt 29992244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 33526413 - 33526356
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
33526413 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 33526356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 587
Target Start/End: Original strand, 33652193 - 33652285
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    ||||||||| ||||  ||||||||||||||||||||||| ||||||||| ||||         || |||||||||||||||||||||||||||    
33652193 taaaatatgattttagtccctgcaaatatgcctcgttttagttttagtttctgtaaattttttttgttgtttttggtccctgcaaaatatttt 33652285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 1526173 - 1526117
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
1526173 aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg 1526117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 1685112 - 1685164
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||  ||||||||||||||||||||||||||||||||    
1685112 aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 1685164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Original strand, 4375692 - 4375740
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
4375692 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 4375740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 4473703 - 4473759
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||| | ||||||||||||||||| ||||    
4473703 aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 4473759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 6146510 - 6146566
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||| ||||||||||||||||  ||| ||||||||||||||||||||||||||||    
6146510 ttttaaagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 6146566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 7272418 - 7272470
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||    
7272418 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 7272470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
11976733 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 11976681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 493 - 541
Target Start/End: Complemental strand, 13779531 - 13779483
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||||||||||| |||| |||||||||||||||||||||||||||||||    
13779531 gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttag 13779483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 14847823 - 14847875
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||| |||||||||||||||||||||||| |||||||||||||    
14847823 aaggttaaaatatgattttgatccctgcaaatatgcctcattttggttttagt 14847875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 16643660 - 16643716
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  ||||||||||||||||| |||||||||||||| ||||    
16643660 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 16643716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 28324185 - 28324125
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||| ||||| |||||||| || |||||||||||||| |||||    
28324185 ttaaggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgt 28324125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 28497253 - 28497305
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| ||||| ||||||||||||||||||||||| ||||||||    
28497253 aaggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagt 28497305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 31445465 - 31445413
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| |||||||||||| |||||||||||| |||||||||||||    
31445465 aaggctaaaatatagttttgatccctacaaatatgcctcattttggttttagt 31445413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 35143845 - 35143789
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||| || ||||||||||||||||||||||||| ||||    
35143845 aggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg 35143789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 40066820 - 40066764
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||| ||||||||||||||| |||||    
40066820 ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgt 40066764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 40844156 - 40844212
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
40844156 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 40844212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Original strand, 42132864 - 42132912
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||| |||||||||||||| |||||||||||||||    
42132864 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 42132912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 585
Target Start/End: Original strand, 42429756 - 42429850
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||| ||||| ||||||||||||  |||||||||||| |||||         || |||||||||||||||||||||||||    
42429756 aaggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatatt 42429850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 497 - 548
Target Start/End: Original strand, 3680532 - 3680583
Alignment:
497 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
3680532 aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgt 3680583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 540
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||  ||||||||||||||||||||||||||||||    
4016906 gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 4016953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 6146948 - 6146893
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
6146948 gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt 6146893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 8094842 - 8094791
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||| ||||||||||||||||||||||||||||    
8094842 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 8094791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 9175368 - 9175321
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| |||||| |||||||||||||||||||||||||    
9175368 taaaatatggttttggtccctgtaaatatgcctcgttttggttttagt 9175321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 10540448 - 10540499
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||| |||||| || |||||||||||||||||||||||||||||    
10540448 aggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagt 10540499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 18549200 - 18549251
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
18549200 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 18549251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 33636321 - 33636372
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
33636321 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 33636372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 540
Target Start/End: Complemental strand, 38930667 - 38930616
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||| ||||  ||||||||||||||||||||||||||||||    
38930667 taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta 38930616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 1408357 - 1408303
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||  |||||||||||||||||| |||| ||||||||    
1408357 ttaaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagt 1408303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 2355883 - 2355937
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| | |||||||||||||||||| ||| ||||||||||||||    
2355883 ttaaggctaaaatataggtttgatccctgcaaatataccttgttttggttttagt 2355937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 18549571 - 18549517
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
18549571 ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgt 18549517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 21125717 - 21125767
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||| |||||  ||||||||||||||||||||||||||||||    
21125717 aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta 21125767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 22650462 - 22650520
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
22650462 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 22650520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 546
Target Start/End: Original strand, 23939547 - 23939601
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 546  Q
    |||||||||||||||||| || ||||||||||| |||||||| ||||||||||||    
23939547 ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagttcct 23939601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 25131447 - 25131397
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  | ||||||||||||||||||||||||||||||    
25131447 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt 25131397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 25600599 - 25600541
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| |||||| |||||||||||||| || |||||||||||||| |||||    
25600599 aaggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgt 25600541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 29158669 - 29158619
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||| ||||||||||||||  |||||||||||||||||    
29158669 ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagt 29158619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 42430120 - 42430070
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |||||||||||||| ||| |||||||||||||    
42430120 ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 42430070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 44998263 - 44998213
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||| || |||||||| |||||||||||||||||    
44998263 ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagt 44998213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 5357762 - 5357713
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||| ||||| ||||||||||||||| ||||||||||||||||    
5357762 gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagt 5357713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 14496813 - 14496866
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||  | ||||||||||||| ||||||||||||||||    
14496813 taaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagt 14496866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 24187899 - 24187842
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||| ||||  |||||||||||||| ||||||||||||||||| ||||    
24187899 aaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg 24187842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 497 - 542
Target Start/End: Original strand, 24814710 - 24814755
Alignment:
497 aaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| |||||||||||||||||| |||||||||||||    
24814710 aaatatggttttggtccctgcaaatatgcctcattttggttttagt 24814755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 540
Target Start/End: Complemental strand, 35345618 - 35345569
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||  | ||||||||||||||||||||||||||||    
35345618 aggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta 35345569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 40492959 - 40493016
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  | |||||||||||| ||||||||||||||||| |||||    
40492959 aggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgt 40493016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 8094478 - 8094534
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  || ||||||||||| ||||||||||||||||| ||||    
8094478 aggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg 8094534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 10755528 - 10755480
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||  |||||||||||||||||||||||| |||||    
10755528 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta 10755480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 14488714 - 14488766
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| |||||  |||||| |||||||||||||||||||||||||    
14488714 aaggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagt 14488766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 493 - 588
Target Start/End: Original strand, 15930933 - 15931028
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||| ||||| | ||| |||||||| ||||||||||||||||| |||||         || ||||||||||||| ||||||||||||||    
15930933 gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccttgcaaaatattttg 15931028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 23939912 - 23939860
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||||| |||||||||||| |||||||||| ||||||    
23939912 aaggttaaaatatggttttgattcctgcaaatatgactcgttttggctttagt 23939860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 29991913 - 29991965
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||| || |||||||||||||||||||| ||||||||    
29991913 aaggttaaaatatggttttggtctctgcaaatatgcctcgttttagttttagt 29991965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #144
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 538
Target Start/End: Complemental strand, 30337223 - 30337171
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    ||||||||||||||||| |||||  |||||||||||||| |||||||||||||    
30337223 ttttaaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt 30337171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #145
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 1162909 - 1162964
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  ||||||||||||||| |||||||| ||||||| ||||    
1162909 ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg 1162964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #146
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 14495394 - 14495340
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||| ||  |||| |||||||||||||||||||||||||||    
14495394 ttaatgctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagt 14495340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #147
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 28258242 - 28258191
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| | | ||||||||||| |||||||||||||||||    
28258242 aggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagt 28258191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #148
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 540
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||| ||||||||||| || |||||||||||||||    
36044791 gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta 36044744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #149
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 540
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||  |||||||||||||| |||||||||||||||    
10776150 ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 10776196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #150
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 15719656 - 15719706
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  |||||||||||||  |||||||||||||||||    
15719656 ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagt 15719706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #151
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 26530666 - 26530724
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||| ||||||||||||  ||| |||||||||||||| |||| ||||||||||||||    
26530666 aaggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctgt 26530724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #152
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 33526052 - 33526102
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||||||||||||||| ||| ||||||||||||    
33526052 ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagt 33526102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #153
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 40844537 - 40844479
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||  |||||||||||||  ||||||||||||||||| |||||    
40844537 aaggttaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgt 40844479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #154
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 43727097 - 43727151
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  ||||||||||||||| | |||||| |||||||||||||    
43727097 ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgt 43727151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #155
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 28399036 - 28398979
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| ||||  ||||||||||||||  |||||||||||||||| |||||    
28399036 aggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgt 28398979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #156
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 492 - 537
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt 537  Q
    ||||||||| |||||||  |||||||||||||||||||||||||||    
40493157 ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt 40493112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #157
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 1408005 - 1408061
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||| |||||||||| |||||||| ||||||| ||||||    
1408005 ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttagctcctgt 1408061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #158
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 528
Target Start/End: Complemental strand, 30969717 - 30969681
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctc 528  Q
    |||||||||||||||||| ||||||||||||||||||    
30969717 ggctaaaatatggttttggtccctgcaaatatgcctc 30969681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #159
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 539
Target Start/End: Complemental strand, 35115640 - 35115592
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||||||||||||||||  ||||| ||||||| |||||||||||||||    
35115640 aggctaaaatatggttttagtccctacaaatatacctcgttttggtttt 35115592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #160
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 2356245 - 2356198
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||| ||||||| | |||||||||| |||||||||||||||||    
2356245 taaaatatgattttgattcatgcaaatatgtctcgttttggttttagt 2356198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #161
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 4376011 - 4375961
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||||||||||||||| ||| ||||||||||||    
4376011 aggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagt 4375961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #162
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 27341257 - 27341308
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |  ||||||||||||||| |||||| |||||||    
27341257 aggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagt 27341308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #163
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 30969399 - 30969454
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| ||| | ||||||||  |||||||||||||||| |||||    
30969399 gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgt 30969454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #164
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 1163274 - 1163224
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||| |||||||||||| |||||| ||||||||    
1163274 ggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagt 1163224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #165
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 534
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttg 534  Q
    ||||||||||| ||||| ||||||||||||||| |||||||||    
9908918 ggctaaaatatagttttaatccctgcaaatatgtctcgttttg 9908960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #166
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 491 - 533
Target Start/End: Complemental strand, 25702810 - 25702768
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgtttt 533  Q
    ||||||||||||||||||| |||||||||||||| ||| ||||    
25702810 aggctaaaatatggttttggtccctgcaaatatgtctcatttt 25702768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #167
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 29487750 - 29487800
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||| ||||  ||||||||||||||  ||||||||||||||||    
29487750 ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagt 29487800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #168
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 32040069 - 32040131
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||| | ||  ||||||||||||||  |||||||||||||||| |||||    
32040069 tttttaggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgt 32040131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #169
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 558 - 588
Target Start/End: Original strand, 32195345 - 32195375
Alignment:
558 ttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||||||||||||||    
32195345 ttattgtttttggtccctgcaaaatattttg 32195375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 6469668 - 6469611
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| ||||| || |||||||||||   ||||||||||||||| |||||    
6469668 aggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgt 6469611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #171
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 7578527 - 7578478
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||| |||||| || |||||||||||| ||| |||||||||||||    
7578527 gctaaaatacggttttaattcctgcaaatatgactcattttggttttagt 7578478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #172
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 19962994 - 19963051
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| ||  ||| |||||||||| |||||||| |||||||| |||||    
19962994 aggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgt 19963051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #173
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 21126022 - 21125965
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| |||||  ||| || ||||||| ||||||||||||||||| |||||    
21126022 aggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgt 21125965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #174
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 490 - 523
Target Start/End: Complemental strand, 22534783 - 22534750
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatat 523  Q
    |||||||||||||| |||||||||||||||||||    
22534783 aaggctaaaatatgcttttgatccctgcaaatat 22534750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #175
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 518 - 547
Target Start/End: Original strand, 24954697 - 24954726
Alignment:
518 aaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||||||||||||    
24954697 aaatatgcctcgttttggttttagttcctg 24954726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 60; Significance: 4e-25; HSPs: 180)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 1614906 - 1614808
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
1614906 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 1614808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 9659691 - 9659593
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
9659691 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 9659593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 489 - 588
Target Start/End: Complemental strand, 45228921 - 45228822
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||| |||||||||||    
45228921 taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgtaaaatattttg 45228822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 5354762 - 5354864
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
5354762 tttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 5354861  T
586 ttg 588  Q
    |||    
5354862 ttg 5354864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 44568692 - 44568594
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
44568692 aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 44568594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 29198663 - 29198566
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
29198663 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 29198566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 490 - 582
Target Start/End: Original strand, 3975547 - 3975639
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaat 582  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||    
3975547 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaat 3975639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 584
Target Start/End: Complemental strand, 16853589 - 16853497
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat 584  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||    
16853589 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaataaaatttgttgtttttggtccctgcaaaatat 16853497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 488 - 588
Target Start/End: Original strand, 46828940 - 46829040
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||         || |||||||||||||||||||||||||||    
46828940 ttaaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatatttt 46829039  T
588 g 588  Q
    |    
46829040 g 46829040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 489 - 588
Target Start/End: Original strand, 41053839 - 41053938
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||| |||||||||||||||||| ||||| ||||||| |||||         || ||||||||||||||||||||||||||||    
41053839 taaggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 41053938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 5234206 - 5234108
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
5234206 aaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 5234108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 8144293 - 8144391
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
8144293 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 8144391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 8 - 235
Target Start/End: Original strand, 18044338 - 18044565
Alignment:
8 cttatatctctgtggttgagttgactgttgattagatctacatgattcttcaaacttgagagtgtcacatcatttcagacccttaacatatattgtttcc 107  Q
    ||||| ||| |||||||||||| |  | ||||| |||| |  |||| |||||| ||  ||||||| |||||||||| |||||| |||||||   ||||||    
18044338 cttatgtctatgtggttgagttaatgggtgatttgatccaattgatccttcaacctatagagtgtgacatcatttcggaccctgaacatatgaggtttcc 18044437  T
108 cccgttgtggtatatttcacttagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagcta 207  Q
    |||| ||| ||| | |  |  ||||||| |||||| ||||||| | || |||||||||||||||||||||| |||| ||||||||| || |  || ||||    
18044438 cccgctgtagtagactatatctagtttgatgttcatatcaatgactgaagtgtccatgattatttggtgtgatttacaacatatgaaaataggcacgcta 18044537  T
208 atttatagaagattatgtgtgtcgtgga 235  Q
    |||| ||| || || |||||||||||||    
18044538 atttgtagtagtttttgtgtgtcgtgga 18044565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 25092550 - 25092452
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||          || ||||||||||||||||||||||||||||    
25092550 aaggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 25092452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 27037587 - 27037689
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    ||||| |||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||          || |||||||||||||||||||||||||    
27037587 ttttatggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatt 27037686  T
586 ttg 588  Q
    |||    
27037687 ttg 27037689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 489 - 587
Target Start/End: Complemental strand, 30223798 - 30223700
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    ||||||||||||||||||||| ||| |||||||||||||||||||||||||||| | |||         || |||||||||||||||||||||||||||    
30223798 taaggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatatttt 30223700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 35838343 - 35838241
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||| ||||||||||||||||    
35838343 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgttttttgtccctgcaaaatatt 35838244  T
586 ttg 588  Q
    |||    
35838243 ttg 35838241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 48854072 - 48853974
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||| ||||||||||||||||||||  |||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
48854072 aaggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 48853974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 587
Target Start/End: Complemental strand, 23399978 - 23399881
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || |||||||||||||||||||||||||||    
23399978 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatatttt 23399881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 25988384 - 25988481
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
25988384 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 25988481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 48192489 - 48192392
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || |||||| |||||||||||||||||||||    
48192489 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttctggtccctgcaaaatattttg 48192392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 22539929 - 22539986
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||    
22539929 aggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt 22539986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 23399606 - 23399667
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
23399606 tttttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23399667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 25988751 - 25988694
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
25988751 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 25988694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 587
Target Start/End: Original strand, 28262712 - 28262808
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    ||||||||||||||||||| |||||||||||||||||| ||||||||||| | |||||         || |||||||||||||||||||||||||||    
28262712 aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaaaaaaaagttgttgtttttggtccctgcaaaatatttt 28262808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 35469880 - 35469976
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||||||  ||||         || ||||||||||||||||||||||||||||    
35469880 ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgtaaaatttttttgttgtttttggtccctgcaaaatattttg 35469976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 8144659 - 8144603
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
8144659 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 8144603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 23676453 - 23676397
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
23676453 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 23676397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 26878072 - 26878016
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
26878072 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 26878016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 3975839 - 3975788
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
3975839 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 3975788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 13770084 - 13770025
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||  |||||||||||||||| |||||||||||||||||||||    
13770084 taaggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgt 13770025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 580
Target Start/End: Original strand, 27458397 - 27458487
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||    
27458397 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaacttgttgtttttggtccctgcaaa 27458487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 34878127 - 34878029
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||| |  ||||         || |||||||||||||||| |||||||||||    
34878127 aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaatctctgtaaattttttttgttgtttttggtccctggaaaatattttg 34878029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 486 - 580
Target Start/End: Complemental strand, 41054242 - 41054148
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||         || ||||||||||||||||||||    
41054242 tttttaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa 41054148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 12894404 - 12894346
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
12894404 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 12894346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 19757746 - 19757804
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
19757746 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 19757804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 26877675 - 26877733
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||    
26877675 taaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg 26877733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 28911908 - 28911850
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
28911908 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 28911850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 580
Target Start/End: Complemental strand, 35470281 - 35470192
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||         ||||||||||| |||||||||||    
35470281 aggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattattgttttttgtccctgcaaa 35470192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 37372906 - 37372848
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
37372906 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgt 37372848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 5233806 - 5233863
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
5233806 aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 5233863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 6108332 - 6108389
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
6108332 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 6108389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 17999722 - 17999665
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
17999722 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 17999665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 25092158 - 25092215
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
25092158 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 25092215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 495 - 544
Target Start/End: Original strand, 25547256 - 25547305
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||    
25547256 taaaatatggttttaatccctgcaaatatgcctcgttttggttttagttc 25547305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 35104296 - 35104239
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||    
35104296 aggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 35104239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 35665876 - 35665933
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||    
35665876 aggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgt 35665933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 35837921 - 35837974
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
35837921 taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35837974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 44509056 - 44508999
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
44509056 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 44508999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 44841359 - 44841412
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||| |||||    
44841359 taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgt 44841412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 48192255 - 48192312
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
48192255 aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 48192312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 1614558 - 1614614
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
1614558 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 1614614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 544
Target Start/End: Original strand, 19561154 - 19561206
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||||    
19561154 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc 19561206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 489 - 588
Target Start/End: Complemental strand, 39520733 - 39520634
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||| ||||||||||||||| ||| |||||||||| ||||||||| ||||||| |||||         || ||||||||||||||||||||||||||||    
39520733 taaggttaaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattttg 39520634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 486 - 589
Target Start/End: Original strand, 44402954 - 44403057
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||||||  |||||||||||||||| | ||||||||||||| |||||          | |||||||||||||||||||||| ||    
44402954 ttttaaggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgtaaaaataaaattttgtttttggtccctgcaaaatttt 44403053  T
586 ttga 589  Q
    ||||    
44403054 ttga 44403057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 46759652 - 46759708
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||    
46759652 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 46759708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 46829312 - 46829256
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||    
46829312 ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgt 46829256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 48852442 - 48852494
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||| ||||||||||||||||||||||| ||||||||    
48852442 aaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagt 48852494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 1006835 - 1006890
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
1006835 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 1006890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 539
Target Start/End: Original strand, 6589021 - 6589068
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||    
6589021 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 6589068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 8555801 - 8555703
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||| | |||||           ||||||||||||||||||||||| |||||    
8555801 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaacaaaaattgtttttggtccctgcaaaattttttg 8555703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 11767281 - 11767179
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||| ||||||||||||||| || ||||||||||||| |||||         || || ||||||||||||| ||||||||    
11767281 tttttaggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgtaaaaaaaatttgttatttttggtccctgaaaaatatt 11767182  T
586 ttg 588  Q
    |||    
11767181 ttg 11767179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 586
Target Start/End: Complemental strand, 12932784 - 12932690
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt 586  Q
    ||||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||||         || ||||||||||||||||||||||||||    
12932784 aggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgt-aaaaaaatttgttgtttttggtccctgcaaaatattt 12932690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 38486791 - 38486740
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||||||| ||||||||| |||||||||||||||    
38486791 aggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagt 38486740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 39438740 - 39438791
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| |||||| |||||||||||||||||||||||||    
39438740 aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagt 39438791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 44508720 - 44508775
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
44508720 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 44508775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 2945847 - 2945789
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||| ||||| ||||| |||||||||||||||||||||||||| |||||    
2945847 aaggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgt 2945789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 3807863 - 3807960
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||| |||||| | |||||||||||| |||||||||||||||||||||||         || ||||||||| ||| ||||||||||||||    
3807863 aggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgtaaaaagaatttgttgtttttgatccttgcaaaatattttg 3807960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 6509206 - 6509264
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||||||||||| |||||||| |||||    
6509206 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgt 6509264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 6509472 - 6509414
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||| |||||||||||||||||||||||||| |||||    
6509472 aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 6509414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 7431951 - 7432001
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||    
7431951 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 7432001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 16940760 - 16940818
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||| ||||||||||| ||||||||||||||||||| |||||||||||| |||||    
16940760 aaggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgt 16940818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 28911576 - 28911673
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||  ||||||||||||||||||||||| |||||||| |||||           ||||||||||||||||||||||| |||||    
28911576 aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttg 28911673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 35015221 - 35015124
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||          || |||||||||||||||||||||| |||||    
35015221 aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaattttttg 35015124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 35210176 - 35210238
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||| |||||||||| ||||||||| ||||||||||||||||| |||||    
35210176 tttttaggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgt 35210238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 44344791 - 44344733
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
44344791 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 44344733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 44568323 - 44568381
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||| |||||||||||||  ||||||||||||||||| ||||    
44568323 taaggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg 44568381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 45021857 - 45021760
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||  |||||||||||||||||| ||||||||||||||| ||          | ||||||||||||||||||||||| |||||    
45021857 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagttcatggtaaaaaaaataattgtttttggtccctgcaaaattttttg 45021760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 45073643 - 45073585
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| |||||  |||||||||||||||||||||||||||||||| |||||    
45073643 aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt 45073585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 493 - 592
Target Start/End: Original strand, 6079810 - 6079906
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttgatcc 592  Q
    ||||||||||||||||  |||||||||||||||||||||||| ||||||| |||||           ||||||||||||||||||||||| |||||||||    
6079810 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaa---attgtttttggtccctgcaaaattttttgatcc 6079906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 16941049 - 16940996
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| |||||||||||||||||| ||||||||||||| |||||    
16941049 taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt 16940996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 20388273 - 20388330
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||||||||||||||||| |||||||||||||| |||||    
20388273 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 20388330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 30223459 - 30223516
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||| ||||||||| ||||||||||||||||| ||||    
30223459 aaggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg 30223516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 39439031 - 39438974
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||| | ||||||||||||||||| ||||    
39439031 aaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 39438974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 39832905 - 39832962
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
39832905 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 39832962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 6589276 - 6589224
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||| ||||||||||||||||| ||||||||||||||    
6589276 aaggttaaaatatggttttggtccctgcaaatatgccttgttttggttttagt 6589224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 6847117 - 6847069
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||| ||||||||||||||| ||||||||||||||||    
6847117 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt 6847069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 9659354 - 9659410
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||    
9659354 aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg 9659410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 10358368 - 10358312
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
10358368 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt 10358312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 539
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||||||||||||| |||||||||||||||||||||||||||||    
11766920 taaaatatggttttggtccctgcaaatatgcctcgttttggtttt 11766964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 14543708 - 14543760
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||| |||||||||||||| ||| |||||||||||||    
14543708 aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 14543760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 17999465 - 17999521
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||| || |||||    
17999465 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgt 17999521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 19561450 - 19561394
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
19561450 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 19561394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 21223750 - 21223698
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||| ||||||||||||||||||    
21223750 aaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt 21223698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
23676135 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 23676187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 29198302 - 29198358
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||  ||||||||||||||||| ||||    
29198302 aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg 29198358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 35210515 - 35210459
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
35210515 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 35210459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 39833236 - 39833180
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  | |||||||||||||||||||||||||||||| |||||    
39833236 ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt 39833180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 46759942 - 46759886
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||    
46759942 ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgt 46759886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 544
Target Start/End: Complemental strand, 48359075 - 48359023
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||||    
48359075 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttc 48359023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 501 - 548
Target Start/End: Complemental strand, 1271590 - 1271543
Alignment:
501 atggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||| |||||||||||||||||||||||||||||||| |||||    
1271590 atggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 1271543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 5355114 - 5355067
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||||    
5355114 taaagtatggttttggtccctgcaaatatgcctcgttttggttttagt 5355067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 18022705 - 18022654
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| ||||  ||||||||||||||||||||||||||||||||    
18022705 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 18022654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 23816669 - 23816720
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
23816669 aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt 23816720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 31503418 - 31503516
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||| |||||||||||||||  ||||| ||||||| ||| ||||||||||||| |||||         || ||||||||||||||||||||||||||||    
31503418 aaggttaaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaaatattttg 31503516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 541
Target Start/End: Original strand, 38186364 - 38186415
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||| ||||||||||||||| |||||||||||||||||||||||| ||||||    
38186364 aaggttaaaatatggttttggtccctgcaaatatgcctcgttttgattttag 38186415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 45073308 - 45073410
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||  |||||||||||| ||||||||||||||||| | |||||          | |||||||||||||||||||||| ||    
45073308 tttttaggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgtaaaaataaaattttgtttttggtccctgcaaaatttt 45073407  T
586 ttg 588  Q
    |||    
45073408 ttg 45073410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 1559707 - 1559649
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||  ||||||| |||||    
1559707 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgt 1559649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 13769774 - 13769824
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||    
13769774 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 13769824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 538
Target Start/End: Complemental strand, 31310683 - 31310633
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||||||  ||||||||||||||| ||||||||||||    
31310683 ttaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt 31310633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 32189388 - 32189334
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  || ||||||||||||||||||||||||||||| |||||    
32189388 ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt 32189334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 38486477 - 38486574
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||| ||||| |||||| ||||||| |||||||| |||||||||||| |         || | ||||||||||||||||||||||||||    
38486477 aggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagttcctctaaaacaaatttgtcgtttttggtccctgcaaaatattttg 38486574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 39520396 - 39520454
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| ||| | |||||||| ||||||||||||||||| |||||    
39520396 aaggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgt 39520454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 44958508 - 44958450
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||| ||||| ||||| |||||||| ||||||||||||||||| |||||    
44958508 aaggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgt 44958450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 45021488 - 45021550
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgtttt-ggttttagttcctg 547  Q
    ||||| |||||||||||||||||  ||||||||||||||||||||||| ||||||||| ||||    
45021488 ttttatggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg 45021550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 540
Target Start/End: Complemental strand, 46648717 - 46648667
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||||  || |||||||||||||||||||||||||||    
46648717 aaggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta 46648667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 488 - 588
Target Start/End: Original strand, 1559339 - 1559439
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    ||||||||||||||| |||||  |||||||||||||||||||||||| ||||| | |||||          | |||||||||||||||||||||| ||||    
1559339 ttaaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgttaaaaaaacattttgtttttggtccctgcaaaatttttt 1559438  T
588 g 588  Q
    |    
1559439 g 1559439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 10358000 - 10358057
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| | ||  |||||||||||||||||||||||||||||||| |||||    
10358000 aggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgt 10358057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 14739006 - 14738949
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  ||||||||||||||| |||||||| ||||||| ||||    
14739006 aaggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg 14738949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 493 - 546
Target Start/End: Original strand, 18022368 - 18022421
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 546  Q
    ||||||||||||||||  |||| ||||||||| |||||||||||||||||||||    
18022368 gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcct 18022421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 20388680 - 20388619
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| |||||||||||||||||  || ||| ||||||||||||||||| |||||||||||||    
20388680 tttatggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgt 20388619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 21554754 - 21554697
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||||||||||||||||| |||||| ||||||| |||||    
21554754 aggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgt 21554697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 30352558 - 30352615
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||  |||||||||||||||||||||||||||| ||| ||||    
30352558 aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg 30352615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 35104076 - 35104133
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||  ||||| |||||||||||||| ||||||||||||||||| ||||    
35104076 aaggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg 35104133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 38186767 - 38186710
Alignment:
486 ttttaaggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |||| | |||||||||||||| |||||||||||||||||    
38186767 ttttaaggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagt 38186710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 39719643 - 39719586
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| |||||||| |||||||| |||||    
39719643 aggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgt 39719586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 1974009 - 1974065
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||||||||||||||  |||||||||||||||| |||||    
1974009 ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt 1974065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||| | ||||||||||| ||||||||||||||||    
6911247 ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta 6911199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 21223399 - 21223455
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||| |||||||||||| ||||  ||||||||||||||| ||||||||||||||||    
21223399 ttttagggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt 21223455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 25547490 - 25547434
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
25547490 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 25547434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 540
Target Start/End: Original strand, 31732101 - 31732149
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||  |||||||||||||||||||||||| |||||    
31732101 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta 31732149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 496 - 548
Target Start/End: Original strand, 37372441 - 37372493
Alignment:
496 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
37372441 aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 37372493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 41364884 - 41364940
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| ||| || |||||||| ||||||||||||||||| |||||    
41364884 ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt 41364940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 45228614 - 45228670
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  ||| |||||||||||||||||| |||||||| ||||    
45228614 aggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg 45228670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 46304084 - 46304136
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| ||||  | ||||||||||||||||||||||||||||||    
46304084 aaggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagt 46304136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 7432249 - 7432202
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| || |||||||||||||||||||||| |||||||    
7432249 taaaatatggttttaattcctgcaaatatgcctcgttttgattttagt 7432202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 19783814 - 19783865
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||| |||||  |||||||||||||| |||||||||||||||||    
19783814 aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt 19783865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 20355407 - 20355458
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| ||||||||| |||||||||| |||||||||||| ||||    
20355407 aggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagt 20355458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 30352904 - 30352849
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||| |||||  |||||||||||||||||||||||| ||||||| ||||    
30352904 ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg 30352849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 30709645 - 30709594
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| ||||  |||||||||||||| |||||||||||||||||    
30709645 aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt 30709594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 490 - 541
Target Start/End: Complemental strand, 31732453 - 31732402
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||||||||||||||||||  ||| |||||||||||||||||||| ||||||    
31732453 aaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag 31732402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 34877777 - 34877824
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| |||||| ||||||| |||||||||||||||||    
34877777 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagt 34877824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 37527421 - 37527366
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| ||||| |||||||| || |||||||||||||| |||||    
37527421 gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgt 37527366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 41365213 - 41365158
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||  | || |||||||||||||||||||||||||||| ||||    
41365213 gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagtttctgt 41365158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 1007229 - 1007179
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||||| |||||||||||||||||| |||||||    
1007229 ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagt 1007179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 5308688 - 5308631
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||| ||| | ||||||||||||| |||||||||||||||||| |||||    
5308688 aaggctaaaatatgttttag-tccctgcaaatatacctcgttttggttttagtccctgt 5308631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #147
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 496 - 542
Target Start/End: Original strand, 6954862 - 6954908
Alignment:
496 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| |||||||||||||  |||||||||||||||||    
6954862 aaaatatggttttggtccctgcaaatatatctcgttttggttttagt 6954908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #148
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 17854151 - 17854205
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  |||||||||||||| ||| ||||||||||||| |||||    
17854151 ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt 17854205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #149
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 21554393 - 21554443
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||| ||||  |||||| |||||||||||||||||||||||||    
21554393 ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagt 21554443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #150
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 23817036 - 23816978
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  || ||| ||||||| ||||||||||| |||||||||||    
23817036 aaggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgt 23816978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #151
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 24717532 - 24717482
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| ||||| | |||||| |||||||||||||||||    
24717532 ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagt 24717482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #152
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 28263069 - 28263015
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||||||||||||  | |||||| ||||||| |||||    
28263069 ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgt 28263015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #153
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 30709321 - 30709375
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||| ||||||||| ||||  ||||| ||||||||||||||||||||||||||    
30709321 ttaaggttaaaatatgattttagtccctacaaatatgcctcgttttggttttagt 30709375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #154
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 36684533 - 36684583
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||| |||||||| |||||||||  |||||||||||||||    
36684533 aaggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta 36684583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #155
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 39719353 - 39719403
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||||| |||||||||||| |||||||||||||    
39719353 ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagt 39719403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #156
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 44403249 - 44403199
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||| |||||||||| |||||||||||||||||    
44403249 ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 44403199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #157
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 6892261 - 6892204
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||| ||| || ||||||| |||||| |||||    
6892261 aggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgt 6892204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #158
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 19465981 - 19465925
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| | ||||||||||||| ||||||| ||||||||| |||||    
19465981 aggctaaaatatggtttt-agccctgcaaatatgtctcgtttcggttttagtccctgt 19465925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #159
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 43300613 - 43300662
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||  | |||||||||||| |||||||||||||||||    
43300613 gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagt 43300662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #160
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 45671217 - 45671270
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||  ||| |||||||||| |||||||| ||||||||||||||    
45671217 taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgt 45671270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #161
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 5308323 - 5308379
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||| |||||||||| |||||||| |||||||| |||||    
5308323 ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgt 5308379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #162
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 28528905 - 28528961
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| | |||| ||||||| ||||||| ||||||||| |||||    
28528905 ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgt 28528961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #163
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 495 - 539
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||||||||||||| || ||||||||||| ||||||||||||||    
28529206 taaaatatggttttggtctctgcaaatatgtctcgttttggtttt 28529162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #164
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 540
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||| ||||  ||||||||||||||| ||||||||||||||    
32189076 ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta 32189124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #165
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 37953057 - 37953001
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||| ||||||||||||||  |||||| ||||||| || ||||||||||||||    
37953057 ttttaaggataaaatatggttttagtccctgtaaatatgtcttgttttggttttagt 37953001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #166
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 505 - 580
Target Start/End: Complemental strand, 41054163 - 41054088
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||| |||||||||||||||||| ||||||||||||| |||||         || ||||||||||||||||||||    
41054163 ttttggtccctgcaaatatgcctcattttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa 41054088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #167
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 46304384 - 46304328
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||| |||||  ||||||||||||||  |||||||||||||||| |||||    
46304384 ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgt 46304328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #168
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 540
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||  || || ||||||||||||||||||||||||    
18311581 gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta 18311628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #169
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 492 - 543
Target Start/End: Original strand, 19005598 - 19005649
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 543  Q
    ||||||||||| |||||| |||||| ||||||| ||||||||| ||||||||    
19005598 ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagtt 19005649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #170
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 31310364 - 31310415
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| ||||  |||||||||||||  |||||||||||||||||    
31310364 aggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagt 31310415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #171
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 31503780 - 31503733
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||  |||||||||||||| ||||||||| |||||||    
31503780 taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 31503733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #172
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 489074 - 489016
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||| ||||  || ||||||||||| ||||||||| ||||||| |||||    
489074 aaggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgt 489016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #173
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 558 - 588
Target Start/End: Original strand, 6911149 - 6911179
Alignment:
558 ttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||||||||||||||    
6911149 ttattgtttttggtccctgcaaaatattttg 6911179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #174
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 518 - 548
Target Start/End: Complemental strand, 22540265 - 22540235
Alignment:
518 aaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||||||||||||    
22540265 aaatatgcctcgttttggttttagttcctgt 22540235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #175
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 486 - 544
Target Start/End: Complemental strand, 24954156 - 24954098
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||| ||||||||||| ||   |||||||||||||  ||||||||||||||||||    
24954156 ttttaaggttaaaatatggtcttagaccctgcaaatatgattcgttttggttttagttc 24954098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #176
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 490 - 524
Target Start/End: Original strand, 41693643 - 41693677
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatg 524  Q
    |||||||||||||| ||||||||||||||||||||    
41693643 aaggctaaaatatgtttttgatccctgcaaatatg 41693677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #177
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 495 - 533
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgtttt 533  Q
    ||||||||||||||| |||||||||||||| ||||||||    
44841711 taaaatatggttttggtccctgcaaatatgactcgtttt 44841673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #178
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 505 - 542
Target Start/End: Complemental strand, 3808106 - 3808069
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||| |||||||||||||| |||||||||||||||||    
3808106 ttttggtccctgcaaatatgtctcgttttggttttagt 3808069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #179
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 540
Target Start/End: Original strand, 12894060 - 12894089
Alignment:
511 tccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||||||||||||||    
12894060 tccctgcaaatatgcctcgttttggtttta 12894089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #180
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 548
Target Start/End: Complemental strand, 19758040 - 19758003
Alignment:
511 tccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| ||||||||||||| |||||    
19758040 tccctgcaaatatgcctcattttggttttagtccctgt 19758003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 60; Significance: 4e-25; HSPs: 142)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 12299142 - 12299044
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||         || |||||| |||||||||||||||||||||    
12299142 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttctggtccctgcaaaatattttg 12299044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 491 - 585
Target Start/End: Complemental strand, 3969010 - 3968916
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
3969010 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 3968916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 3414386 - 3414483
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||| ||||||||||||||    
3414386 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg 3414483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 20467719 - 20467622
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||          || ||||||||| ||||||||||||||||||    
20467719 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgcaaaaaaaatttgttgtttttgatccctgcaaaatattttg 20467622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 21993786 - 21993883
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
21993786 aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 21993883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 22543353 - 22543450
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
22543353 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 22543450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 21385586 - 21385488
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||          || ||||||||||||||||||||||||||||    
21385586 aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 21385488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 6412217 - 6412314
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
6412217 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 6412314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 25137358 - 25137261
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||| ||||||||||||| |||||    
25137358 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaatttttttttgttgtttttagtccctgcaaaatgttttg 25137261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 1007510 - 1007453
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
1007510 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 1007453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 19321132 - 19321075
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
19321132 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttactgt 19321075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 12419939 - 12419883
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
12419939 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 12419883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 17765007 - 17765106
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
17765007 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtttctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttg 17765106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 21994404 - 21994348
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
21994404 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 21994348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 32885672 - 32885728
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
32885672 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 32885728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 486 - 580
Target Start/End: Original strand, 1007118 - 1007212
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||         || ||||||||||||||||||||    
1007118 tttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa 1007212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 488 - 547
Target Start/End: Complemental strand, 6412583 - 6412524
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||    
6412583 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg 6412524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 12419707 - 12419758
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||    
12419707 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 12419758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 587
Target Start/End: Original strand, 12757607 - 12757705
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    ||||||||||||||||||||| |||||||||||||| |||||||||||||||||  ||||         || ||||||||||||||| |||||||||||    
12757607 taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgtaattttttttttttgtttttggtccctacaaaatatttt 12757705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 23502546 - 23502444
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||||||  |||||||||||||| ||||||||||||||| | |||||         || |||||||| ||||||||||||||||    
23502546 ttttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgtaattttttgttgttgttttttgtccctgcaaaatatt 23502447  T
586 ttg 588  Q
    |||    
23502446 ttg 23502444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 488 - 547
Target Start/End: Complemental strand, 24274135 - 24274076
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
24274135 ttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 24274076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 580
Target Start/End: Complemental strand, 10910965 - 10910876
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||    
10910965 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaataaatttgttgtttttggtccctgcaaa 10910876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 13268105 - 13268159
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||| |||||||||||||||||||||| |||||||||    
13268105 ttaaggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagt 13268159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 19690391 - 19690449
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
19690391 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 19690449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 25136992 - 25137050
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||    
25136992 aaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgt 25137050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 487 - 588
Target Start/End: Original strand, 34582524 - 34582625
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt 586  Q
    |||| |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||          | |||||||||||||||||||||| |||    
34582524 tttatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaaattttt 34582623  T
587 tg 588  Q
    ||    
34582624 tg 34582625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 489 - 542
Target Start/End: Complemental strand, 3276357 - 3276304
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||| |||||||||||||| |||||||||||||||||    
3276357 taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 3276304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 3968643 - 3968700
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
3968643 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 3968700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 15076206 - 15076149
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
15076206 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 15076149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 21147403 - 21147460
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||    
21147403 aggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgt 21147460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 21385249 - 21385306
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
21385249 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 21385306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 539
Target Start/End: Original strand, 23502235 - 23502284
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||    
23502235 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt 23502284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 24273826 - 24273883
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||||||||    
24273826 aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg 24273883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 33801745 - 33801688
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
33801745 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 33801688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 543
Target Start/End: Complemental strand, 778043 - 777991
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 543  Q
    |||||||||||||||||| |||||||||||||||||||||||| |||||||||    
778043 aggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtt 777991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 7156161 - 7156105
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
7156161 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 7156105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 15962389 - 15962333
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
15962389 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 15962333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 22543719 - 22543663
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
22543719 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 22543663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 493 - 588
Target Start/End: Complemental strand, 30479421 - 30479326
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||| | | |||||||||||||||||||||||||||| |||||         || ||||||||||||| ||||||||||||||    
30479421 gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttggtccttgcaaaatattttg 30479326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 1214997 - 1214946
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||| ||||||||||| |||||||||||||||||    
1214997 aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagt 1214946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 8170152 - 8170101
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||||||    
8170152 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8170101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 494 - 580
Target Start/End: Original strand, 13617531 - 13617617
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||    
13617531 ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa 13617617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 14656263 - 14656204
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |||||    
14656263 taaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt 14656204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
31198615 ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 31198670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 494405 - 494455
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||||    
494405 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 494455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 18024376 - 18024279
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||         || |||||||| |||| ||||||||||||||    
18024376 aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaaaaaaatttgttgttttttgtccttgcaaaatattttg 18024279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 487 - 588
Target Start/End: Original strand, 19267560 - 19267661
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt 586  Q
    |||| |||||||||||||||||| |||||| |||||||| |||||||||||||||| |||||         ||  |||||||||||| ||||||||||||    
19267560 tttatggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgtgaaaaaaatttgctgtttttggtccttgcaaaatattt 19267659  T
587 tg 588  Q
    ||    
19267660 tg 19267661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 21995062 - 21995120
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||| ||||||||||||||||||||||| |||||    
21995062 aaggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgt 21995120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 24901239 - 24901289
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |||||||||||||| |||||||||||||||||    
24901239 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 24901289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 26375691 - 26375741
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||    
26375691 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta 26375741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 30928679 - 30928737
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
30928679 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 30928737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 493 - 547
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
31166871 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 31166925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 34990321 - 34990259
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||| ||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
34990321 ttttaaggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 34990259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 318098 - 318041
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||||||||||||  |||||||||||||||| |||||    
318098 aggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgt 318041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 3414754 - 3414697
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||| ||||||| ||||||||||||||||| ||||    
3414754 aaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg 3414697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 7155795 - 7155852
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||| |||||  |||||||||||||||||||||||||||||||| ||||    
7155795 aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg 7155852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 8681118 - 8681061
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  ||||||||||||||||| |||||||||||||| ||||    
8681118 aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 8681061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 20467349 - 20467406
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| |||||||| |||||| |||||||||||||||||||||||||||||||| ||||    
20467349 aaggataaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg 20467406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 22822653 - 22822596
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||    
22822653 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 22822596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 25431855 - 25431798
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
25431855 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 25431798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 26376042 - 26375989
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
26376042 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 26375989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 34582893 - 34582836
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||||||||||||| |||||||||||||||||| |||||    
34582893 aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgt 34582836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 1890453 - 1890397
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||    
1890453 aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 1890397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 3356140 - 3356192
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
3356140 aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt 3356192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 8680774 - 8680830
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||||||||| ||||    
8680774 aggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg 8680830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 14655378 - 14655434
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  ||||||||||||||| |||||||||||||||| ||||    
14655378 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 14655434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 15962026 - 15962082
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  ||| |||||||||||||||||||||||||||| ||||    
15962026 aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg 15962082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 19129335 - 19129391
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||| ||||||| |||| |||||||||||||||||||||||||||||||| ||||    
19129335 aggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg 19129391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 19296407 - 19296359
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||||    
19296407 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 19296359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 22792901 - 22792849
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||| |  ||||||||||||||||||||||||||||||||    
22792901 aaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagt 22792849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 30929044 - 30928988
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
30929044 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 30928988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 496 - 547
Target Start/End: Original strand, 543365 - 543416
Alignment:
496 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||  |||||||||||||||||||||||||||||||| ||||    
543365 aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 543416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 2615871 - 2615922
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||||||||||||| ||||||||||||||||||    
2615871 aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt 2615922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 3356495 - 3356448
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||    
3356495 taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 3356448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 585
Target Start/End: Complemental strand, 7324189 - 7324099
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    ||||||||||||||  ||||||||||||||| |||||||||||||||| |||||          | |||||||||||||||||||||||||    
7324189 taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt 7324099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 13150752 - 13150654
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||| || | ||||||||||||| ||||||||||||||||| |||||         |  |||||||||||||||||||||| |||||    
13150752 aaggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgtaaacagaaatatttgtttttggtccctgcaaaattttttg 13150654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 14428651 - 14428706
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
14428651 gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt 14428706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 23770162 - 23770217
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
23770162 gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 23770217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 2373177 - 2373235
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||||| ||||||||| |||| |||||    
2373177 aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgt 2373235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 6468308 - 6468366
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||| | |||||||||||||| |||||    
6468308 aaggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt 6468366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 11448533 - 11448587
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||| ||||  |||||||||||||| |||||||||||||||||    
11448533 ttaaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt 11448587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 11449171 - 11449113
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||| ||||||||||||||||||||||| |||| |||||    
11449171 aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgt 11449113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 495 - 588
Target Start/End: Complemental strand, 12176640 - 12176547
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||  |||||||||||||| ||||||||||||||||| |||||          | |||||||||||||||||||||| |||||    
12176640 taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaattttttg 12176547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 12612365 - 12612303
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||| ||  ||||||||||||||||||||||| |||||||| |||||    
12612365 tttttaggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgt 12612303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| ||||||||||||| |||||||||| |||||||    
15442937 ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt 15442987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 17771911 - 17771961
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||||||||||||||| ||||||||||||||||    
17771911 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 17771961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 580
Target Start/End: Complemental strand, 19129521 - 19129432
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||||||| ||||| |||||||||||||| | ||||||||||||||| |||||         || ||||||||||||||||||||    
19129521 aggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaa 19129432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 33131852 - 33131794
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||  |||||||||||||||||||||||||||| |||||    
33131852 aaggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgt 33131794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 539
Target Start/End: Complemental strand, 2616242 - 2616193
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||||||  ||||||||||||||||| |||||||||||    
2616242 aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt 2616193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 494 - 547
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||  |||||||||||||||||| ||||||||||||| ||||    
5286949 ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg 5286896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 539
Target Start/End: Original strand, 6591113 - 6591162
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||||||  |||| ||||||||||||||||||||||||    
6591113 aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt 6591162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 587
Target Start/End: Complemental strand, 15722901 - 15722805
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||||| |||||||| ||||||||||||||| || |||||||||||  ||||         || |||||||||||| ||||||||||||||    
15722901 aggctaaaatatagttttgattcctgcaaatatgccttgtgttggttttagtctctgtaaattttttttgttgtttttggtctctgcaaaatatttt 15722805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 18024014 - 18024067
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| ||  |||||||||||||||||||||||||||| |||||    
18024014 taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgt 18024067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 25121497 - 25121440
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| | ||||||||||||  |||||||||||||||| |||||    
25121497 aggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgt 25121440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 9896639 - 9896587
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||| || ||||||||||||||    
9896639 aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt 9896587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 10910629 - 10910685
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| || || |||||||| ||||||||||||||||| |||||    
10910629 ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgt 10910685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 544
Target Start/End: Complemental strand, 11129543 - 11129491
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||||||| ||||  ||||||||||||||||||||||||||||| ||||    
11129543 ggctaaaatatgattttactccctgcaaatatgcctcgttttggttttcgttc 11129491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 504 - 548
Target Start/End: Complemental strand, 13617804 - 13617760
Alignment:
504 gttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||| |||||||||||||||||||||||||||||||| |||||    
13617804 gttttggtccctgcaaatatgcctcgttttggttttagtccctgt 13617760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #99
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 21995425 - 21995369
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||| ||||||||||||||||||||| |||||| |||||    
21995425 ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgt 21995369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #100
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 22822305 - 22822357
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  || |||||||||| ||||||||||||||||||    
22822305 aaggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt 22822357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #101
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 24692980 - 24692924
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| ||||    
24692980 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg 24692924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #102
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 31186591 - 31186535
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  | ||||||||||||||||||||| |||||||| |||||    
31186591 ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgt 31186535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #103
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 33808619 - 33808675
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||| ||||||||||||||||| ||||||| ||||    
33808619 aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg 33808675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #104
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 486 - 541
Target Start/End: Original strand, 317806 - 317861
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||| |||||||||||| |||||  |||||||||||||| ||||||||||||||||    
317806 tttttaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttag 317861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #105
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 540
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||  |||||||||||||| |||||||||||||||    
494751 gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 494704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #106
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 6564944 - 6564894
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||| |||||||| |||||||||||||| |||||||||||||||||    
6564944 aggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagt 6564894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #107
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 12298825 - 12298872
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| |||||||||||||| |||||||| ||||||||    
12298825 taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagt 12298872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #108
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 490 - 580
Target Start/End: Complemental strand, 17765377 - 17765287
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||| ||||| |||||||||||||| ||||||||  ||||||| |||||         || ||||||||||||||||||||    
17765377 aaggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgtaaatttttgttgttgtttttggtccctgcaaa 17765287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #109
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 25121183 - 25121233
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |||| |||||||||| |||||||||||||||||    
25121183 aggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagt 25121233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #110
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 25431573 - 25431632
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| |||| ||||||| |||||||  |||||||| |||||||||||||    
25431573 taaggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgt 25431632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #111
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 31167200 - 31167145
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||| ||||||||| ||||||| ||||    
31167200 ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg 31167145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #112
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 9896280 - 9896334
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| ||||||||||||||| ||| |||| |||||||| |||||    
9896280 ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgt 9896334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #113
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 14655897 - 14655959
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||| |||||||| ||||||||| |||||||||||||   |||||||||||||||| |||||    
14655897 ttttagggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgt 14655959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #114
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 19296106 - 19296164
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||| ||||||||  ||||||||||||||| |||||||| ||||||| |||||    
19296106 aaggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgt 19296164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #115
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 540
Target Start/End: Original strand, 19320769 - 19320815
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||| |||||||||||||| ||| |||||||||||    
19320769 ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta 19320815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #116
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 491 - 533
Target Start/End: Complemental strand, 23770440 - 23770398
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgtttt 533  Q
    ||||||||||||||||||  |||||||||||||||||||||||    
23770440 aggctaaaatatggttttagtccctgcaaatatgcctcgtttt 23770398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #117
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 777675 - 777732
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||| ||||  | ||||||||||| |||||||||||||||||| ||||    
777675 aaggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg 777732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #118
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 1214693 - 1214746
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| |||||| |||||||||||||| | | |||||||||||||    
1214693 taaggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagt 1214746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #119
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 1875501 - 1875558
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| | ||| |||||||||||||||||||||||||| ||| || |||||    
1875501 aggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctgt 1875558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #120
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 1890057 - 1890114
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||  |||||| ||||||||||||||||| ||||||| ||||    
1890057 aaggttaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg 1890114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #121
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 494 - 543
Target Start/End: Complemental strand, 6591440 - 6591391
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 543  Q
    |||||||||||||||  | |||||||||||| ||||||||||||||||||    
6591440 ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtt 6591391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #122
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 10091039 - 10091092
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||  ||||||||||||||  |||||||||||||||| |||||    
10091039 taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt 10091092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #123
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 544
Target Start/End: Complemental strand, 11926034 - 11925981
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    ||||||||||||||||||| || ||| ||||||| | |||||||||||||||||    
11926034 aggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagttc 11925981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #124
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 489 - 542
Target Start/End: Complemental strand, 14428953 - 14428900
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| |||||||||||||||  ||| ||||||||||| ||||||||||||||||    
14428953 taagactaaaatatggttttagtccttgcaaatatgcttcgttttggttttagt 14428900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #125
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 15722609 - 15722666
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| ||  |||||||||| ||||||||| ||||||| |||||    
15722609 aggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgt 15722666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #126
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 23628799 - 23628848
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||| |||||||||||||   ||||||||||||||||    
23628799 gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagt 23628848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #127
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 34989962 - 34990011
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||| ||||  |||||||||||||||||||||||| |||||||    
34989962 gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagt 34990011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #128
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 6564580 - 6564632
Alignment:
491 aggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||| ||||||||| | |||||||||||||| |||||||||||||||||    
6564580 aggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagt 6564632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #129
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 486 - 545
Target Start/End: Original strand, 15116667 - 15116724
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc 545  Q
    |||| ||||||||||||||||||  || ||||||||||  ||||||||||||||||||||    
15116667 tttttaggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagttcc 15116724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #130
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 30239287 - 30239343
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||| |||||||||||| ||||  | |||||||||||| |||||||||||||||||    
30239287 ttttatggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagt 30239343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #131
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 31398543 - 31398491
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| ||||  |||||||||||||| ||| |||||||||||||    
31398543 aaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt 31398491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #132
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 489 - 528
Target Start/End: Complemental strand, 15117043 - 15117004
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctc 528  Q
    ||||||||||||||||||||  ||||||||||||||||||    
15117043 taaggctaaaatatggttttagtccctgcaaatatgcctc 15117004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #133
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 31276339 - 31276284
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||  |||||| |||||||||||||| ||||||||| ||||||| |||||    
31276339 gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgt 31276284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #134
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 11925739 - 11925789
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||| ||||| ||||| |||||||||||||| ||||||||| |||||||    
11925739 ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagt 11925789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #135
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 19267914 - 19267856
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| | |||| ||||||| | | ||||||||||||| |||||    
19267914 aaggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgt 19267856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 496 - 534
Target Start/End: Complemental strand, 19690755 - 19690717
Alignment:
496 aaaatatggttttgatccctgcaaatatgcctcgttttg 534  Q
    |||||||||||||| |||||||||||||| |||||||||    
19690755 aaaatatggttttggtccctgcaaatatgtctcgttttg 19690717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 491 - 537
Target Start/End: Original strand, 30479062 - 30479108
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtt 537  Q
    ||||||||||||||||||| |||||| ||||||| | ||||||||||    
30479062 aggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt 30479108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #138
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 540
Target Start/End: Complemental strand, 543725 - 543676
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||| ||||  ||||||||||||||| | ||||||||||||    
543725 aggctaaaatatgattttagtccctgcaaatatgctttgttttggtttta 543676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #139
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 7323862 - 7323924
Alignment:
490 aaggctaaaatatggttttgat----ccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| ||    || |||||||||| ||||||||||||||||| |||||    
7323862 aaggctaaaatatggttttaattagcccttgcaaatatgtctcgttttggttttagtccctgt 7323924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #140
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 492 - 545
Target Start/End: Original strand, 12611995 - 12612048
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc 545  Q
    |||||||||||||| ||  ||||||||||||||||  ||||| |||||||||||    
12611995 ggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagttcc 12612048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #141
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 505 - 542
Target Start/End: Complemental strand, 19275223 - 19275186
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||| |||||||||||||| |||||||||||||||||    
19275223 ttttggtccctgcaaatatgtctcgttttggttttagt 19275186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #142
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 24901555 - 24901498
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| ||||| ||||| |||||||| ||  ||||||||||||| |||||    
24901555 aggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgt 24901498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 60; Significance: 4e-25; HSPs: 227)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 43441605 - 43441507
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
43441605 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 43441507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 490 - 585
Target Start/End: Original strand, 31480134 - 31480229
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
31480134 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 31480229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 19844583 - 19844485
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||         || ||||||||||||||||||||||||||||    
19844583 aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 19844485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 51550452 - 51550350
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||||||    
51550452 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttggtccctgcaaaatatt 51550353  T
586 ttg 588  Q
    |||    
51550352 ttg 51550350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 28552020 - 28552117
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||         || ||||||||||||||||||||||||||||    
28552020 aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattttg 28552117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 47336582 - 47336485
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
47336582 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 47336485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 492 - 585
Target Start/End: Original strand, 49323782 - 49323875
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
49323782 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 49323875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 54608864 - 54608767
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
54608864 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 54608767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 9261789 - 9261885
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
9261789 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttggtccctgcaaaatattttg 9261885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 490 - 585
Target Start/End: Complemental strand, 12741273 - 12741178
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||||||||||||    
12741273 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 12741178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 45002020 - 45002076
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
45002020 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg 45002076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 490 - 585
Target Start/End: Complemental strand, 45002387 - 45002292
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
45002387 aaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 45002292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 9603628 - 9603679
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
9603628 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 9603679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 21159823 - 21159721
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||          | |||||||||||||||||||||| ||    
21159823 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaatttt 21159724  T
586 ttg 588  Q
    |||    
21159723 ttg 21159721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 580
Target Start/End: Original strand, 35565506 - 35565596
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||         |||||||||||||||||||||||    
35565506 aaggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgtaattttttgttattgtttttggtccctgcaaa 35565596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 47005525 - 47005423
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||| | |||         || |||||||||||||||||||||||||    
47005525 tttttaggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatatt 47005426  T
586 ttg 588  Q
    |||    
47005425 ttg 47005423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 25615973 - 25616031
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
25615973 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 25616031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 46751267 - 46751321
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
46751267 ttaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 46751321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 548
Target Start/End: Original strand, 4513258 - 4513319
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
4513258 tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 4513319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 488 - 580
Target Start/End: Complemental strand, 9597099 - 9597007
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||         || ||||||||||||||||||||    
9597099 ttaaggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 9597007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 486 - 547
Target Start/End: Complemental strand, 20612904 - 20612843
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
20612904 ttttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 20612843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 587
Target Start/End: Original strand, 22008521 - 22008621
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt 586  Q
    ||||||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||| ||||||||||||    
22008521 tttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaattgttgtttttggtccttgcaaaatattt 22008620  T
587 t 587  Q
    |    
22008621 t 22008621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 587
Target Start/End: Original strand, 22016039 - 22016139
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt 586  Q
    ||||||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||| ||||||||||||    
22016039 tttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaattgttgtttttggtccttgcaaaatattt 22016138  T
587 t 587  Q
    |    
22016139 t 22016139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 26090078 - 26089982
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||||| |||||||||||    
26090078 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgtaaaatattttg 26089982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 54608516 - 54608573
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
54608516 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 54608573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 489 - 588
Target Start/End: Original strand, 474041 - 474140
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          ||  |||||||||||||||||||||||||||    
474041 taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttggtgtttttggtccctgcaaaatattttg 474140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 474409 - 474353
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
474409 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 474353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 4035053 - 4034997
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||    
4035053 ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgt 4034997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 585
Target Start/End: Original strand, 8940158 - 8940253
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| |||||||||||||||||| |||||||||| |||||||||||||||||| |||||         || |||||||||||||||||||||||||    
8940158 aaggttaaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 8940253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 14772205 - 14772261
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||    
14772205 ttttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt 14772261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 28552384 - 28552328
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
28552384 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 28552328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 489 - 588
Target Start/End: Complemental strand, 35569139 - 35569040
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||| ||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||| ||||||||||||||    
35569139 taaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg 35569040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 39288899 - 39288843
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
39288899 aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 39288843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 487 - 590
Target Start/End: Complemental strand, 45313868 - 45313765
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt 586  Q
    |||| |||||||||||||||||| ||||||||||||||| |||||||| ||||||| |||||         || | ||||||||||||||||||||||||    
45313868 tttatggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaattttagtttttagtttttggtccctgcaaaatattt 45313769  T
587 tgat 590  Q
    ||||    
45313768 tgat 45313765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 487 - 547
Target Start/End: Original strand, 47336223 - 47336283
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
47336223 tttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 47336283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 51550081 - 51550137
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
51550081 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 51550137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 1721454 - 1721356
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||          | |||| |||||||||||||||||||||||    
1721454 aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaaatttttgtgttgtatttggtccctgcaaaatattttg 1721356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 3387261 - 3387320
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||    
3387261 ttaaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg 3387320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 9262156 - 9262105
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
9262156 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 9262105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 22008890 - 22008835
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
22008890 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 22008835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 43441270 - 43441325
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
43441270 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg 43441325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Complemental strand, 48924243 - 48924184
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||    
48924243 taaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgt 48924184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 4950035 - 4950093
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
4950035 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 4950093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 40370589 - 40370539
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||    
40370589 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt 40370539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 51834605 - 51834663
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
51834605 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 51834663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 580
Target Start/End: Original strand, 4034717 - 4034805
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||    
4034717 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 4034805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 4513625 - 4513564
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
4513625 tttaaggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgt 4513564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 8940527 - 8940470
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
8940527 aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 8940470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 10977343 - 10977286
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| ||| ||||||||||||||||||||||||||||||||| ||||    
10977343 aaggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg 10977286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 12740901 - 12740962
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
12740901 tttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 12740962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 15979702 - 15979606
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
15979702 aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatattttg 15979606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 28427610 - 28427553
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
28427610 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 28427553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 29955667 - 29955610
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||    
29955667 aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 29955610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 30004822 - 30004765
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||    
30004822 aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 30004765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 30106221 - 30106164
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||    
30106221 aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt 30106164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 30128283 - 30128340
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||    
30128283 aggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgt 30128340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 30130157 - 30130214
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
30130157 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 30130214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 32119586 - 32119529
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||    
32119586 aaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 32119529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 37507224 - 37507167
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
37507224 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37507167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 39437111 - 39437054
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
39437111 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 39437054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 584
Target Start/End: Original strand, 40370285 - 40370377
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat 584  Q
    |||||||||||| ||||| |||||||||||||| |||||||| ||||||||||||||         || ||||||||||||||||||||||||    
40370285 ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaaatat 40370377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 44802282 - 44802377
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||  ||||||||||||||| ||||||||||||||||||||||         || |||||||||||||||| |||||||||||    
44802282 ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctg-aaaatattttg 44802377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 3152112 - 3152056
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
3152112 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 3152056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 3387606 - 3387554
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||| || |||||||||||||||||||||||||||||    
3387606 aaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagt 3387554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 585 - 649
Target Start/End: Complemental strand, 14743859 - 14743795
Alignment:
585 tttgatccgttttacattccttggtttcttcttcctcattagagattggtggtggtgagtaggtg 649  Q
    ||||||||||||||||||||||||||||||||||||||||| || | ||||||| ||||| ||||    
14743859 tttgatccgttttacattccttggtttcttcttcctcattaaaggtaggtggtgatgagtcggtg 14743795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 489 - 541
Target Start/End: Original strand, 21553886 - 21553938
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| |||||||    
21553886 taaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttag 21553938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 25710870 - 25710814
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
25710870 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 25710814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 485 - 588
Target Start/End: Original strand, 35936773 - 35936876
Alignment:
485 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat 584  Q
    ||||||||||||||||||||||||| ||||| ||||||| | |||||||||||||| | || ||         || ||||||||||||||||||||||||    
35936773 gttttaaggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccccgtaatttttttttgttgtttttggtccctgcaaaatat 35936872  T
585 tttg 588  Q
    ||||    
35936873 tttg 35936876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 37506866 - 37506922
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
37506866 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 37506922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 45320983 - 45320923
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
45320983 ttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 45320923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 3151749 - 3151800
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
3151749 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 3151800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 3830517 - 3830466
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
3830517 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 3830466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 10976978 - 10977033
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
10976978 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 10977033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 11463233 - 11463288
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||    
11463233 gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgt 11463288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 15286155 - 15286206
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |||||||||||||||| ||||||||||||||||    
15286155 aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagt 15286206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 15979338 - 15979393
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
15979338 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 15979393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 26089730 - 26089785
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
26089730 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 26089785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 29490744 - 29490693
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| |||||||||||||| |||||||||||||||||    
29490744 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 29490693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 31480500 - 31480445
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||    
31480500 ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg 31480445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 487 - 542
Target Start/End: Original strand, 39288568 - 39288623
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||||  |||||||||||||| |||||||||||||||||    
39288568 tttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 39288623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 494 - 588
Target Start/End: Complemental strand, 45006247 - 45006153
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||| |||||  |||||||||||||||||||||||||||||| | |||||         || ||||||||||||||||||||||||||||    
45006247 ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 45006153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 580
Target Start/End: Original strand, 47005152 - 47005242
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||||||||||||||||||| |||||||||||||| |||||||| |||||||| |||||         || ||||||||||||||||||||    
47005152 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgtaatttttttttgttgtttttggtccctgcaaa 47005242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 313 - 475
Target Start/End: Complemental strand, 4159953 - 4159791
Alignment:
313 tccctcaccatataaagtaagaatttta--acagtcttgaaccagttcagattatataatccaaacatttcttggtcatgttcggataatatcattcgaa 410  Q
    ||||||||| || |||||| ||| ||||  |||||||||||||||||  ||  |||||| |||||||||| | ||   |||||  || |||| |||| ||    
4159953 tccctcaccctaaaaagtatgaactttatcacagtcttgaaccagtttcga--atataaaccaaacatttttgggatgtgttcacattatataattcaaa 4159856  T
411 atagttcagagtttcgatggttacttgttcagcaagagtaacttattgaacatgtttttctttgg 475  Q
    |||||||| ||||| |||| ||||||| | ||||||| ||||| |||||||| ||||||||||||    
4159855 atagttcaaagtttggatgattacttgcttagcaagactaactcattgaacacgtttttctttgg 4159791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 5345691 - 5345633
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
5345691 aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt 5345633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 493 - 547
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
22156292 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 22156238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 25610134 - 25610080
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||||| |||||||||||||||||||||||| |||||||    
25610134 ttaaagctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagt 25610080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 27681683 - 27681586
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||| || || ||||||||||||||||||||||||||| | |||||         || ||||||||| ||||||||||||||||||    
27681683 aggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgtaatatttttttgttgtttttgatccctgcaaaatattttg 27681586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 28452146 - 28452243
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| ||| |||||||||| || |||||||||||||| | |||         || ||||||||||||||||||||||||||||    
28452146 aggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 28452243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 28942908 - 28942850
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  | |||||||||||||||||||||||||||||| ||||    
28942908 taaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg 28942850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 30268503 - 30268561
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
30268503 aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 30268561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 32119219 - 32119316
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||| |||||| |||||||||||||| |||||||| |||||||| ||||          || ||||||||||||||||||||||||||||    
32119219 aggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 32119316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 35177253 - 35177311
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||| ||||| |||||||||||||| |||||||||||||||||| ||||    
35177253 aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtttctgt 35177311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 485 - 547
Target Start/End: Original strand, 39436711 - 39436773
Alignment:
485 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| |||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
39436711 gtttaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 39436773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 40545558 - 40545620
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||||||| |||||||||||||| |||||||| |||||||| |||||    
40545558 tttttaggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt 40545620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 540
Target Start/End: Complemental strand, 40979712 - 40979662
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||    
40979712 aaggctaaaatatggttttaatccctgcaaatatggctcgttttggtttta 40979662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 587
Target Start/End: Original strand, 46724545 - 46724638
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||| ||||||||| |||||||||  |||||||| |||||||| |||||         ||||||||||||||||||||||||||||||    
46724545 ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaaatatttt 46724638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 50196301 - 50196355
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
50196301 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 50196355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 488 - 542
Target Start/End: Complemental strand, 52342587 - 52342533
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||  || |||||||||||||||||||||||||||||    
52342587 ttaaggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagt 52342533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 3830133 - 3830190
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||||||| ||||||||||||| |||||    
3830133 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt 3830190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 488 - 588
Target Start/End: Complemental strand, 4322193 - 4322093
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||| |||||||| |||||| |||||||||||||| || |||||||||||||| |||||         || ||||||||||| |||||||||||||||    
4322193 ttaaggttaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaatttcttttgttgtttttggttcctgcaaaatatttt 4322094  T
588 g 588  Q
    |    
4322093 g 4322093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 540
Target Start/End: Complemental strand, 9603920 - 9603871
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||||    
9603920 aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta 9603871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 13584369 - 13584312
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  ||||||||||||||||| |||||||||||||| ||||    
13584369 aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg 13584312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 20611017 - 20611070
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||  ||||||||||||||| ||||||||||||||||    
20611017 taaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 20611070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 26799886 - 26799943
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||| ||||||||||||||||||||||||| ||||    
26799886 aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg 26799943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 30034473 - 30034416
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |||||    
30034473 aggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgt 30034416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 35407791 - 35407734
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||||||||||||||||| || ||||| |||||||| |||||    
35407791 aggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgt 35407734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 40169342 - 40169399
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| ||||||||||||||| ||||||||| ||||||| ||||    
40169342 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg 40169399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 52342194 - 52342243
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||| |||||||||||||||||| |||||||||||    
52342194 aggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta 52342243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 3361824 - 3361768
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||| ||||||||||||||||  ||||||||||||||||| ||||||||||||||    
3361824 ttttaaagctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt 3361768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 7957226 - 7957170
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||| ||||||||||||||| |||||||||||||||| |||||    
7957226 ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgt 7957170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 9863404 - 9863348
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  || ||||||||||||||||||||||||||||| |||||    
9863404 ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt 9863348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 15016388 - 15016444
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||||||||||||||||| |||||||||||||| |||||    
15016388 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt 15016444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 16123139 - 16123195
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||| ||||||||||||||||||||||||| |||||    
16123139 ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt 16123195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 28452377 - 28452321
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| ||||| ||||||||| |||||||||||||||| ||||    
28452377 aggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg 28452321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 543
Target Start/End: Original strand, 28942524 - 28942576
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 543  Q
    ||||||||||||||||||  ||||||||||||||||| |||||||||||||||    
28942524 aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtt 28942576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 29445954 - 29446010
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
29445954 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 29446010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 29525099 - 29525155
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||||  |||||||||||||| |||||||| ||||||||    
29525099 ttttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagt 29525155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||||||||||| ||||||||| ||||||| ||||    
45005889 taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg 45005941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 46186773 - 46186721
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||| ||||||||||||||||||||||||||||    
46186773 aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt 46186721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 47114485 - 47114537
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| ||||| |||||||||||||| |||||||||||||||||    
47114485 aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt 47114537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||| |  |||||||||||||||||||||||||||||||| ||||    
51500686 aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg 51500630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 51834943 - 51834887
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  ||||||||||||||| |||||||||||||||| ||||    
51834943 aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg 51834887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 53701663 - 53701607
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
53701663 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 53701607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 540
Target Start/End: Complemental strand, 2486905 - 2486854
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||| |||||||||||||||| ||||||||||||||| ||||||||||||||    
2486905 taagactaaaatatggttttggtccctgcaaatatgcttcgttttggtttta 2486854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 489 - 540
Target Start/End: Original strand, 4814537 - 4814588
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||||  |||||||||||||| |||||||||||||||    
4814537 taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta 4814588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 7588317 - 7588368
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||| |||||| ||||||||||||||||| ||||||||||||||    
7588317 aggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagt 7588368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 8510214 - 8510269
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||||||| ||||||||||||| ||||    
8510214 ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg 8510269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 12673642 - 12673740
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||| |||||  |||||| ||||||||||||||||||||||||| |||||          | |||||||||||||||||||||| |||||    
12673642 aaggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgtaaaaataaaattttgtttttggtccctgcaaaattttttg 12673740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 494 - 541
Target Start/End: Original strand, 14633547 - 14633594
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||    
14633547 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag 14633594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 20907454 - 20907407
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||| ||||||||||||||||||| |||||||||||||    
20907454 taaaatatggttttaatccctgcaaatatgcctcattttggttttagt 20907407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 494 - 588
Target Start/End: Original strand, 30034109 - 30034203
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||| ||| || ||||||||||||||||||||||| | | |||         || ||||||||||||||||||||||||||||    
30034109 ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 30034203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 34238597 - 34238648
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
34238597 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 34238648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 863280 - 863377
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||| ||||| ||| |||||||||| |||||||| ||||||||  ||||         || ||||||||||||||||||||||||||||    
863280 aggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 863377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 587
Target Start/End: Original strand, 2486581 - 2486674
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||||||||  |||||||||||||| ||| ||||||||||||||| |||         || ||||||||||||| |||||||||||||    
2486581 ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagttcatgtaattttatttttttgtttttggtccttgcaaaatatttt 2486674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 544
Target Start/End: Complemental strand, 7518444 - 7518394
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||||||||||  |||||||||||||| |||||||||||||||||||    
7518444 ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagttc 7518394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 29678022 - 29678080
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| |||||| ||  |||||||||||||||||||||||||||| |||||    
29678022 aaggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgt 29678080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 29686870 - 29686820
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||| |||||||||||||||||| ||| ||||||||||||||||    
29686870 ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagt 29686820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 29955300 - 29955354
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  |||||||||||||||||||||||| ||||||| |||||    
29955300 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt 29955354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 30004454 - 30004508
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  |||||||||||||||||||||||| ||||||| |||||    
30004454 ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt 30004508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 31869596 - 31869650
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| || |||||||||||| ||||||||||||||||| |||||    
31869596 ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgt 31869650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 38232237 - 38232291
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||| ||||| |||||||||||||| ||||||||| |||||||    
38232237 ttaaggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagt 38232291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 40277820 - 40277870
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||| |||||||| ||||||||||||||| ||||||||||||||    
40277820 aaggctaaaatgtggttttggtccctgcaaatatgcttcgttttggtttta 40277870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 536
Target Start/End: Complemental strand, 44802550 - 44802504
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggt 536  Q
    |||||||||||||| |||||||||||||||||||| |||||||||||    
44802550 aaggctaaaatatgattttgatccctgcaaatatgtctcgttttggt 44802504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 20404889 - 20404946
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| | ||||||||||| ||||||| ||||||||||| ||||    
20404889 aggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagtttctgt 20404946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 22155923 - 22155984
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| ||||    
22155923 tttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 22155984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 25609766 - 25609862
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| ||  | |||||| ||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
25609766 aggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaaatattttg 25609862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 488 - 580
Target Start/End: Original strand, 29686540 - 29686632
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||| |||||||||||| ||| |||||||||| || |||||||||||||| |||||         || ||||||||||||||||||||    
29686540 ttaaggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgtaatatttttttgttgtttttggtccctgcaaa 29686632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 31869957 - 31869900
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| |||||||| |||||||| |||||    
31869957 aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt 31869900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 488 - 545
Target Start/End: Complemental strand, 36673249 - 36673192
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc 545  Q
    |||| ||||||||||||||||| |||||||||||||| ||  ||||||||||||||||    
36673249 ttaacgctaaaatatggttttggtccctgcaaatatgacttattttggttttagttcc 36673192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 50196658 - 50196601
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||||| ||||||||||||||||| |||||||| |||||    
50196658 aggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgt 50196601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 539
Target Start/End: Original strand, 53113441 - 53113490
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||||||| |||||||||||||| ||||||||| ||||    
53113441 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt 53113490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 275443 - 275499
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  ||||||||| |||||||||||||| ||||||| ||||    
275443 aggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg 275499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 4814904 - 4814849
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||||  ||| |||||||||| |||||||||||||||||    
4814904 ttttaaggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagt 4814849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 7518088 - 7518140
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||| ||  ||||||||||||||||||||||| ||||||||    
7518088 aaggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagt 7518140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 19656539 - 19656591
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||| |||||||||||||||||||| |||||||    
19656539 aaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagt 19656591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 19844265 - 19844321
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| ||||| |||||||||||||||||  ||||||| |||||    
19844265 ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgt 19844321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 20757781 - 20757725
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||| |||| ||||||| |||||||| ||||||||||||||||    
20757781 tttttaggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagt 20757725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 21159451 - 21159503
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| |||||||    
21159451 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 21159503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 28427244 - 28427300
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  | |||||||||||| ||||||||||||||||| ||||    
28427244 aggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg 28427300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 34238917 - 34238865
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||| |||||||||| ||||||||||||||||    
34238917 aaggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagt 34238865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 46622130 - 46622074
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| ||| ||||||||||  |||||||||||||||| ||||    
46622130 aggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg 46622074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| |||||| ||||||| ||||||||||||||||| ||||    
49324143 taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg 49324091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 493 - 541
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||||||||||||| |  |||||||||||||||||||||||||||||||    
51760117 gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag 51760069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 490 - 580
Target Start/End: Complemental strand, 863654 - 863564
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    |||| ||||||||||||||| ||||||||||||||  |||||||| ||||||| |||||         || ||||||||||||||||||||    
863654 aaggttaaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa 863564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 8555305 - 8555258
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| ||| ||||||||||| ||||||||||||||||    
8555305 taaaatatggttttggtccatgcaaatatgcatcgttttggttttagt 8555258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 9596759 - 9596814
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||  || |||||||||||| |||||||||||||||| |||||    
9596759 gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgt 9596814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 13514578 - 13514527
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| ||||| | |||||||||||| |||||||||||||||||    
13514578 aggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagt 13514527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #168
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 20757403 - 20757450
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||| ||||  ||||||||||||||||||||||||||||||||    
20757403 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 20757450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #169
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 29446207 - 29446156
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| || ||||||||||||||    
29446207 aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt 29446156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #170
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 40169654 - 40169599
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||| ||||||||| ||||||| ||||    
40169654 ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg 40169599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #171
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 51759817 - 51759915
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||| |  | |||||||||||| ||||||||||||||||| |||||           ||||||||||||||||||||||| |||||    
51759817 aaggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttg 51759915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #172
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 1721083 - 1721145
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||| ||||||||||||||| ||| |||||||||| ||| ||||||||||||| |||||    
1721083 tttttaggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgt 1721145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #173
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 313 - 475
Target Start/End: Complemental strand, 4144141 - 4143979
Alignment:
313 tccctcaccatataaagtaagaattttaaca--gtcttgaaccagttcagattatataatccaaacatttcttggtcatgttcggataatatcattcgaa 410  Q
    ||||||||| || |||||| ||| |||||||  |||||||||| ||||  |  |||||| |||||||||| | ||   |||||  || |||| |||| ||    
4144141 tccctcaccctaaaaagtatgaactttaacaaggtcttgaaccggttccaa--atataaaccaaacatttttgggatgtgttcacattatataattcaaa 4144044  T
411 atagttcagagtttcgatggttacttgttcagcaagagtaacttattgaacatgtttttctttgg 475  Q
    ||||| || ||||| |||| ||||||| | ||||||| ||||| |||||||| ||||||||||||    
4144043 atagtccaaagtttggatgattacttgcttagcaagactaactcattgaacacgtttttctttgg 4143979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #174
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 10778368 - 10778426
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||  |  ||||||||||||||||||||| |||||||||||||    
10778368 aaggttaaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctgt 10778426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #175
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 20644878 - 20644820
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||| |||||| || ||||||| ||||||| |||||    
20644878 aaggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgt 20644820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #176
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 492 - 545
Target Start/End: Complemental strand, 275833 - 275780
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcc 545  Q
    |||||||||||| ||||  |||||| |||||||| |||||||||||||||||||    
275833 ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagttcc 275780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #177
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 4321945 - 4321994
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||| |||||| |||||||||| ||| |||||||||||    
4321945 aggctaaaatatggttctgatccttgcaaatatgtctcattttggtttta 4321994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Complemental strand, 11463480 - 11463431
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| | || ||||||| |||||||||||||||||||||    
11463480 gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagt 11463431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 14633891 - 14633834
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||| |||||||||  |||||||||||||| || |||||||||||||| ||||    
14633891 aaggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg 14633834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 20405224 - 20405167
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||| ||||||||||||| | | ||||| |||||||| |||||    
20405224 aggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgt 20405167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #181
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 25710509 - 25710566
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||| ||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
25710509 aggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 25710566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #182
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 492 - 541
Target Start/End: Complemental strand, 29678387 - 29678338
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||||||||||| ||||| ||||||||||||||||  |||||||||||||    
29678387 ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttag 29678338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #183
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 489 - 542
Target Start/End: Complemental strand, 30130507 - 30130454
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||| ||||||||||||  || ||||||||||||||| |||||||||||||    
30130507 taaggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagt 30130454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #184
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 30552480 - 30552423
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||| |||||  ||| |||||||||| ||||||||||||||||| ||||    
30552480 aaggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg 30552423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #185
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 40545836 - 40545783
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||| ||||| |||||||||||||| ||| ||||||||||||| |||||    
40545836 taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgt 40545783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #186
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 45521841 - 45521780
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||| ||||||||||||||  ||  ||||||||||  ||||||||||||||||||||||    
45521841 tttaaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt 45521780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #187
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 46186410 - 46186459
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||| ||||  |||||||||||||||||||||||| |||||||    
46186410 gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagt 46186459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #188
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 46901103 - 46901160
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  || |||||||||||  ||||||||||||||||| ||||    
46901103 aggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagtttctgt 46901160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #189
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 50009284 - 50009189
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||| |||||||||| ||| |||||||||||||||||||| ||||| | |||||         || |||||||| |||||||||||||||||||    
50009284 ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgtaatttttgttt-ttgttttttgtccctgcaaaatattttg 50009189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #190
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 534
Target Start/End: Complemental strand, 53113757 - 53113716
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttg 534  Q
    ||||||||||||||||||||| ||||||||| ||||||||||    
53113757 gctaaaatatggttttgatccatgcaaatatacctcgttttg 53113716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #191
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 488 - 548
Target Start/End: Complemental strand, 12673985 - 12673925
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||| ||||||||| ||||  | |||||||||||||||| |||||||||||||| ||||    
12673985 ttaaggttaaaatatgattttagttcctgcaaatatgcctcattttggttttagtttctgt 12673925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #192
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 20644505 - 20644561
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||| |||||| |||||||||||||| ||| ||||| ||||||| |||||    
20644505 ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgt 20644561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #193
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 21971046 - 21970994
Alignment:
496 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| ||| || |||||||||||||||||| |||||||| ||||    
21971046 aaaatatggttttaatctctacaaatatgcctcgttttgattttagtttctgt 21970994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #194
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 496 - 548
Target Start/End: Complemental strand, 21993482 - 21993430
Alignment:
496 aaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| ||| || |||||||||||||||||| |||||||| ||||    
21993482 aaaatatggttttaatctctacaaatatgcctcgttttgattttagtttctgt 21993430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #195
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 534
Target Start/End: Original strand, 25353197 - 25353241
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttg 534  Q
    ||||||| |||||||||||  ||||||||||||||||||||||||    
25353197 aaggctagaatatggttttagtccctgcaaatatgcctcgttttg 25353241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #196
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 488 - 544
Target Start/End: Original strand, 27200434 - 27200490
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||| |||||||||||||| ||||||||||||||  ||| |||| ||||||||||    
27200434 ttaaggttaaaatatggttttaatccctgcaaatatatctcattttagttttagttc 27200490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #197
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 489 - 541
Target Start/End: Original strand, 35533276 - 35533328
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||| |||||||||||||||| || ||||||||||| || |||||||||||||    
35533276 taagactaaaatatggttttggtctctgcaaatatgtcttgttttggttttag 35533328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #198
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 488 - 548
Target Start/End: Original strand, 36732636 - 36732696
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||| ||||||| ||||||| |||||||||||||| ||  |||||||||||||| ||||    
36732636 ttaaggttaaaataaggttttggtccctgcaaatatgtcttattttggttttagtttctgt 36732696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #199
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 39072213 - 39072165
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||  | |||||||||||||||||||||| |||||    
39072213 ggctaaaatatggttttagttcctgcaaatatgcctcgttttgatttta 39072165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #200
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 43440493 - 43440545
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||| |||||||||| |||||||| ||||||||    
43440493 aaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagt 43440545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #201
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 43440785 - 43440737
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||  ||||  ||||||||||||||||||||||||||||||||    
43440785 ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagt 43440737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #202
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 45161107 - 45161163
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||| | |||||||||||||   |||||||||||||| |||||||||||||||||    
45161107 ttttaaagttaaaatatggtttaagtccctgcaaatatgtctcgttttggttttagt 45161163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #203
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 49670803 - 49670747
Alignment:
492 ggctaaaatatggttttgatccc-tgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||| ||||||||||| |||||||||||||||| ||||    
49670803 ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg 49670747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #204
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 501 - 580
Target Start/End: Complemental strand, 52956691 - 52956612
Alignment:
501 atggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||| || |||||||||||| |||||||||||||||||  |||         |||||||||||||||||||||||    
52956691 atggttttggtctctgcaaatatgcatcgttttggttttagtttttgtaaattttttttattgtttttggtccctgcaaa 52956612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #205
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 53701361 - 53701417
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| ||| ||||||||||||||  |||| |||||||| |||||    
53701361 ggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgt 53701417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #206
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 9863050 - 9863096
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||  ||||||||| ||||||||||||||||||||||    
9863050 taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagt 9863096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #207
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 513 - 544
Target Start/End: Complemental strand, 16123481 - 16123450
Alignment:
513 cctgcaaatatgcctcgttttggttttagttc 544  Q
    ||||||||||||||||||||||||||||||||    
16123481 cctgcaaatatgcctcgttttggttttagttc 16123450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #208
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 487 - 530
Target Start/End: Complemental strand, 26273829 - 26273786
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgt 530  Q
    ||||||||||||||||||||||  |||| |||||||||||||||    
26273829 tttaaggctaaaatatggttttagtcccagcaaatatgcctcgt 26273786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #209
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 28418899 - 28418844
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| ||||||||||||||  | |||||| ||||||| |||||    
28418899 gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgt 28418844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #210
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 34582520 - 34582579
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  ||| |||||||||||||| |  |||||||||||||| ||||    
34582520 ttaaggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg 34582579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #211
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 495 - 542
Target Start/End: Original strand, 36672966 - 36673013
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| || ||||||||||| || ||||||||||||||    
36672966 taaaatatggttttggtctctgcaaatatgtcttgttttggttttagt 36673013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #212
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 46724901 - 46724846
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||||||||  | |||||| ||||||| |||||    
46724901 gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgt 46724846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #213
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 51500397 - 51500448
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||| |  || ||| |||||||||||||||||||||||||    
51500397 aggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagt 51500448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #214
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 20644578 - 20644612
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||||||| ||||||||||||||    
20644578 ttttgatccctgcaaatatgtctcgttttggtttt 20644612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #215
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 30424628 - 30424678
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  |||||||||||||| || ||||| ||||||||    
30424628 ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagt 30424678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #216
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 30426226 - 30426177
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||| |||||||||||||||||||| |||||||    
30426226 ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagt 30426177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #217
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 486 - 524
Target Start/End: Complemental strand, 39132912 - 39132874
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatg 524  Q
    |||| ||||||||||||||||||| ||||||||||||||    
39132912 tttttaggctaaaatatggttttggtccctgcaaatatg 39132874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #218
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 494 - 540
Target Start/End: Original strand, 46621778 - 46621824
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||| ||||||||||| ||||||||||||| |||| ||||||    
46621778 ctaaaatattgttttgatcccagcaaatatgcctcattttagtttta 46621824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #219
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 513 - 542
Target Start/End: Original strand, 590197 - 590226
Alignment:
513 cctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||||||||||||    
590197 cctgcaaatatgcctcgttttggttttagt 590226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #220
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 498 - 547
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
498 aatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||  ||||||||||||||  |||||||||||||||| ||||    
8510523 aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg 8510474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #221
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 486 - 523
Target Start/End: Complemental strand, 20585709 - 20585672
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatat 523  Q
    |||| ||||||||||||| |||||||||||||||||||    
20585709 tttttaggctaaaatatgtttttgatccctgcaaatat 20585672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #222
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 502 - 539
Target Start/End: Complemental strand, 25610061 - 25610024
Alignment:
502 tggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||| |||||||||||||| ||||||||||||||    
25610061 tggttttggtccctgcaaatatgtctcgttttggtttt 25610024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #223
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 495 - 540
Target Start/End: Complemental strand, 35177563 - 35177518
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||| |||| ||||||||||| || |||||||||||    
35177563 taaaatatggttttcatccttgcaaatatgcttccttttggtttta 35177518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #224
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 505 - 542
Target Start/End: Original strand, 35565581 - 35565618
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||| |||||||||||||||||| |||||||||||||    
35565581 ttttggtccctgcaaatatgcctcattttggttttagt 35565618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #225
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 490 - 543
Target Start/End: Complemental strand, 40279337 - 40279284
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtt 543  Q
    |||||||||||||||||||| ||  |||||||||| || |||||| ||||||||    
40279337 aaggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagtt 40279284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #226
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 47114804 - 47114747
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| |||||| ||| |||||||||   ||||||| ||||||||||||||    
47114804 aggctaaaatatagttttggtccttgcaaatatatttcgttttagttttagttcctgt 47114747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #227
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 54767524 - 54767471
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||| |||||  ||||||| ||||||||| ||||||| |||||    
54767524 taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgt 54767471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 60; Significance: 4e-25; HSPs: 200)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 24507845 - 24507747
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
24507845 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattttg 24507747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 489 - 588
Target Start/End: Complemental strand, 12360971 - 12360872
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
12360971 taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattttg 12360872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 3247196 - 3247294
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
3247196 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 3247294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 19720710 - 19720808
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
19720710 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 19720808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 38164297 - 38164199
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
38164297 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 38164199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 47819598 - 47819500
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
47819598 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 47819500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 8140433 - 8140530
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
8140433 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 8140530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 492 - 585
Target Start/End: Complemental strand, 38151212 - 38151119
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
38151212 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt 38151119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 24653802 - 24653898
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
24653802 ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 24653898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 493 - 588
Target Start/End: Original strand, 44157696 - 44157791
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || |||||||| |||||||||||||||||||    
44157696 gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttagtccctgcaaaatattttg 44157791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 486 - 584
Target Start/End: Complemental strand, 8140805 - 8140707
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatat 584  Q
    |||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||    
8140805 ttttaaggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatat 8140707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 492 - 590
Target Start/End: Original strand, 10631164 - 10631262
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttgat 590  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || |||||||||||||| |||||||||||||||    
10631164 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattttgat 10631262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 15526364 - 15526266
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
15526364 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 15526266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 24507479 - 24507534
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
24507479 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg 24507534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 490 - 588
Target Start/End: Original strand, 30322927 - 30323025
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
30322927 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattttg 30323025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 10887599 - 10887502
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||| |         || ||||||||||||||||||||||||||||    
10887599 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatattttg 10887502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 19623020 - 19622962
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
19623020 taaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg 19622962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 492 - 585
Target Start/End: Original strand, 33000305 - 33000398
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||         || |||||||||||||||||||||||||    
33000305 ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 33000398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 33045692 - 33045634
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
33045692 aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt 33045634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 35307713 - 35307771
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
35307713 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt 35307771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 45638895 - 45638798
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||| ||||| |         || ||||||||||||||||||||||||||||    
45638895 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcctataaaaaaaaattgttgtttttggtccctgcaaaatattttg 45638798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 35056530 - 35056626
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
35056530 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 35056626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 40718110 - 40718206
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
40718110 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattttg 40718206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 45380636 - 45380540
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||          || ||||||||||||||||||||||||||||    
45380636 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattttg 45380540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 489 - 588
Target Start/End: Original strand, 29072494 - 29072593
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||           ||||||||||||||||||||||| |||||    
29072494 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaattttttg 29072593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 29688430 - 29688378
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
29688430 aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 29688378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 47819231 - 47819287
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
47819231 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 47819287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 52254181 - 52254233
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
52254181 aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt 52254233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 24978124 - 24978026
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||| |||||| |||  |||||||||||||||||||||||||||||||||         || ||||||||||||| ||||||||||||||    
24978124 aaggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgtaaattttttttgttgtttttggtccttgcaaaatattttg 24978026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 1810925 - 1810983
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
1810925 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 1810983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 587
Target Start/End: Original strand, 8364614 - 8364711
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||| ||||||||||||||||||||||||||||||  ||||||||||||||||  ||||         || |||||||||||||||||||||||||||    
8364614 aaggttaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgtaatttttttttgttgtttttggtccctgcaaaatatttt 8364711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 544
Target Start/End: Complemental strand, 15058768 - 15058714
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    ||||||||||||| ||||||||||||||||||||| |||||||||||||||||||    
15058768 aaggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagttc 15058714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 587
Target Start/End: Original strand, 15211509 - 15211606
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    |||||||||||||||||||| |||||| ||||||| |||||||||||||||||  ||||         || |||||||||||||||||||||||||||    
15211509 aaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgtaaatttttgttgttgtttttggtccctgcaaaatatttt 15211606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 17129691 - 17129745
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||| |||||    
17129691 ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgt 17129745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 18302393 - 18302331
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
18302393 ttttgaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 18302331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 486 - 548
Target Start/End: Original strand, 18899833 - 18899895
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||| ||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
18899833 ttttaaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 18899895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 26324584 - 26324681
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||| ||| ||||||||||||||    
26324584 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttgatccttgcaaaatattttg 26324681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 31061154 - 31061096
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||||||||||||||||  ||||||||||||||||| ||||    
31061154 taaggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg 31061096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 32626527 - 32626585
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| |||||||||||||||||||||||    
32626527 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt 32626585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 32729052 - 32728994
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
32729052 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 32728994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 33234544 - 33234602
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||    
33234544 aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt 33234602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 39747836 - 39747739
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||| ||| ||||||||||||||    
39747836 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttgatccttgcaaaatattttg 39747739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 45368488 - 45368546
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
45368488 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 45368546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Complemental strand, 3247568 - 3247507
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
3247568 tttttaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 3247507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 10631530 - 10631473
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
10631530 aaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg 10631473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 13770488 - 13770545
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
13770488 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 13770545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 22919683 - 22919740
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
22919683 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 22919740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 26061954 - 26062011
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
26061954 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 26062011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 31060787 - 31060883
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||| || |||||||||||||| ||||          || ||||||||||||||||||||||||||||    
31060787 ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattttg 31060883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 33000671 - 33000614
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
33000671 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 33000614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 38163929 - 38163986
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
38163929 aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 38163986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 990380 - 990324
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
990380 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 990324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 11822002 - 11822054
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
11822002 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 11822054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 15516581 - 15516637
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||    
15516581 aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg 15516637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 16026939 - 16026883
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||    
16026939 aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg 16026883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 16060885 - 16060829
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||    
16060885 ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt 16060829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 18473271 - 18473327
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
18473271 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 18473327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 18473597 - 18473545
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
18473597 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 18473545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 30323294 - 30323238
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||    
30323294 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 30323238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 33379886 - 33379938
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||    
33379886 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 33379938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 35005750 - 35005694
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||||||  ||||||||||||||||||||||||||||||||    
35005750 tttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 35005694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 35056895 - 35056839
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||    
35056895 aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 35056839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 35308111 - 35308055
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
35308111 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 35308055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 41358368 - 41358424
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
41358368 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 41358424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 41358664 - 41358608
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||||||||    
41358664 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg 41358608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 491 - 547
Target Start/End: Original strand, 45380271 - 45380327
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
45380271 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 45380327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 497 - 548
Target Start/End: Original strand, 2939934 - 2939985
Alignment:
497 aaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||||||||||||||||||||||||||||||| |||||    
2939934 aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt 2939985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 3753214 - 3753269
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
3753214 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 3753269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 588
Target Start/End: Complemental strand, 5058994 - 5058896
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||| ||||||||||||||| |||||| ||||||||||||||||| ||||||| |||||         || |||||||||| |||||||||||||||||    
5058994 aaggttaaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgtaaatttttgttgttgtttttgggccctgcaaaatattttg 5058896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 7001897 - 7001842
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
7001897 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg 7001842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 7819104 - 7819053
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| ||| |||||||||||||||||||||||||||||    
7819104 aggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagt 7819053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 12361008 - 12361067
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||  ||||||||||| |||||||||||||||||||| |||||    
12361008 taaggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgt 12361067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 18928148 - 18928046
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||| ||||||||||||||||| || ||||||||||| ||| |||| |||||||| || ||         ||||||||||||||||||||||||||||    
18928148 ttttaaagctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtcccggtaacatttttttattgtttttggtccctgcaaaatatt 18928049  T
586 ttg 588  Q
    |||    
18928048 ttg 18928046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 490 - 541
Target Start/End: Complemental strand, 24654169 - 24654118
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||    
24654169 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag 24654118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 24977778 - 24977833
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
24977778 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 24977833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 31258335 - 31258394
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||  |||||| ||||||||||||||||||||||||| ||||    
31258335 ttaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg 31258394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 38136981 - 38136926
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||    
38136981 ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 38136926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 45638580 - 45638635
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||    
45638580 ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg 45638635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 46868577 - 46868522
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||    
46868577 ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg 46868522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Original strand, 990085 - 990143
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  ||||| |||||||||||||||||||||||||| ||||    
990085 taaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg 990143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 3679624 - 3679682
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||| |||||||||||||||||||||||||| |||||    
3679624 aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt 3679682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 3753574 - 3753516
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||| ||||||||||||||||||||||||| |||||    
3753574 aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt 3753516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 4789310 - 4789364
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
4789310 ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt 4789364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 6567498 - 6567440
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
6567498 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 6567440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 492 - 585
Target Start/End: Complemental strand, 12322970 - 12322877
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||| | |||||         || ||||||||||||| |||||||||||    
12322970 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgtaaatttttgttgttgtttttggtccttgcaaaatatt 12322877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 495 - 588
Target Start/End: Complemental strand, 15335292 - 15335199
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||| ||||  ||||||||||||||||||||||||||||||||||||||          | |||||||||||||||||||||| |||||    
15335292 taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaataaaaattttgtttttggtccctgcaaaattttttg 15335199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 26442901 - 26442843
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
26442901 aaggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgt 26442843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 486 - 544
Target Start/End: Complemental strand, 42483277 - 42483219
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||||||||||||||||||| ||||||||||||||| | ||||||||||| ||||    
42483277 ttttaaggctaaaatatggttttggtccctgcaaatatgctttgttttggttttggttc 42483219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 10887227 - 10887288
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||||||| ||||||||||||||  |||||||||||||||| ||||    
10887227 tttttaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg 10887288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 14007488 - 14007545
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
14007488 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 14007545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 15058419 - 15058468
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||| |||||||||||||| |||||||||||||||||    
15058419 gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagt 15058468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 21391095 - 21391152
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
21391095 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt 21391152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 492 - 541
Target Start/End: Original strand, 24649350 - 24649399
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||    
24649350 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag 24649399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 32454295 - 32454238
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  ||||||||||||||||||||||||| |||||| |||||    
32454295 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgt 32454238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 33045354 - 33045411
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||| |||||||| ||||||||||||||||| |||||||||||||| |||||    
33045354 aggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgt 33045411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 33234912 - 33234816
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||||          | ||||||||| ||||||||||||||||||    
33234912 ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaatttttgtgttgtttttgatccctgcaaaatattttg 33234816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 35005442 - 35005499
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||||||||||||| ||||||| ||||    
35005442 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg 35005499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 37545622 - 37545683
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||| |||||||||||||||||  ||| |||||||||||||||||||||||||||| ||||    
37545622 ttttatggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg 37545683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 38150846 - 38150903
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
38150846 aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 38150903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 44641079 - 44641128
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||  ||||||||||||||||||||||||||||||||    
44641079 gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt 44641128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 44641437 - 44641376
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| |||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
44641437 tttatggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 44641376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 45290455 - 45290512
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
45290455 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 45290512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 48956066 - 48955970
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||  ||||||||||||||||| |||||||||||||| |||||          | |||||||||||||||||||||| |||||    
48956066 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttg 48955970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 50429210 - 50429153
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||||||||| |||||    
50429210 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt 50429153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 50799129 - 50799186
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||||||| ||||||||||||| |||||    
50799129 aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt 50799186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 13260322 - 13260266
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
13260322 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 13260266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 16060594 - 16060645
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||| ||||| ||||||||||||||||||||||||||    
16060594 aaggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagt 16060645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 17984331 - 17984383
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||   ||||||||||||||||||||||||||||||||    
17984331 aaggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagt 17984383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 19622649 - 19622705
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
19622649 tttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 19622705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||| ||||| |||||||||||||||||||||||||||||||| ||||    
19721071 taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg 19721019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 22953556 - 22953500
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||| ||||||    
22953556 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagatcctgt 22953500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 29072862 - 29072806
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  ||||||||||||||||||| |||||||||||| |||||    
29072862 ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgt 29072806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 41738796 - 41738852
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| |||||||||||||||||| |||| |||||||| |||||    
41738796 ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgt 41738852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 589
Target Start/End: Original strand, 42482978 - 42483077
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt-nnnnnnnnnttattgtttttggtccctgcaaaatattttga 589  Q
    ||||||||||||||||||| |||||||||||||| ||| |||||||||||||  ||||          || |||||||||||||||||||||||||||||    
42482978 aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattttga 42483077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 44158044 - 44157992
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||||| ||||||||||||||    
44158044 aaggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagt 44157992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 45290821 - 45290765
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||  |||| ||||||||||||||||||||||||||| ||||    
45290821 aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg 45290765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 494 - 542
Target Start/End: Original strand, 46183686 - 46183734
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||| ||||||||||||||| ||||||||||||||||    
46183686 ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt 46183734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 52254479 - 52254423
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||||| ||||||| |||||    
52254479 ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt 52254423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 7818783 - 7818838
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||| |||||  ||||||||||||||||||||||||||||||||| ||||    
7818783 gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtttctgt 7818838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 19198948 - 19198893
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| ||||||||||||||| ||||| ||||||| |||||    
19198948 gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgt 19198893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 41881089 - 41881148
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||  ||||| |||||||| ||||||||||||||||| ||||    
41881089 ttaaggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg 41881148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 48609595 - 48609544
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
48609595 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 48609544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 48955713 - 48955764
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| ||||  ||||||||||||||||||||||||||||||||    
48955713 aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 48955764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 7867359 - 7867301
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||| |||||||||||||| ||  ||||||||||||| |||||    
7867359 aaggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgt 7867301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 12322604 - 12322654
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||||||||||||||||  |||||||| |||||||    
12322604 ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagt 12322654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 541
Target Start/End: Original strand, 12360602 - 12360652
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    ||||||||||||||||||| |||||||||||||||||| |||| |||||||    
12360602 aggctaaaatatggttttggtccctgcaaatatgcctcattttagttttag 12360652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 538
Target Start/End: Complemental strand, 15211858 - 15211812
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||| ||| ||||||||||||||||||||||||    
15211858 ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttt 15211812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 540
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||| |||||||||||||| |||||||||||||||    
17130081 ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 17130035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 17984701 - 17984651
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||| ||||  ||||||||||||||||||||||||||||||||    
17984701 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 17984651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 18079396 - 18079454
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||||| ||| |||||||||||||| ||||||||||||| |||||    
18079396 aaggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgt 18079454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 25658299 - 25658245
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||  |||||||||||||||||||||||||||||| ||||||| |||||    
25658299 ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgt 25658245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 26191359 - 26191409
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||||||||||||||| ||||||||||||||||    
26191359 ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt 26191409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 26191734 - 26191684
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||    
26191734 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 26191684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 26207280 - 26207334
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||| ||| |||||||||| ||||||||||||||||| |||||    
26207280 ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt 26207334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #135
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 26442563 - 26442613
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||    
26442563 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 26442613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #136
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 28507459 - 28507362
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||| |||||| |||||||||||||| ||| |||| |||||||| |||||         || ||||||||||||||||||||| ||||||    
28507459 aggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgtaattttttatttttgtttttggtccctgcaaaacattttg 28507362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #137
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 493 - 547
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||    
32420099 gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg 32420153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #138
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 34002942 - 34002884
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||||||||||||| || |||||||||||||| |||||    
34002942 aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgt 34002884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #139
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 489 - 539
Target Start/End: Original strand, 37624743 - 37624793
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||||||||| |  |||||||||||||||||||||||||||||    
37624743 taaggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt 37624793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #140
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 39025381 - 39025332
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| |||||||||| |||||||||||||||||||||    
39025381 ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagt 39025332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #141
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 586
Target Start/End: Complemental strand, 41739121 - 41739029
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattt 586  Q
    ||||||||||||||||||  |||||||||||||   |||||||||||||||| |||||         || ||||||||||||||||||||||||||    
41739121 aggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgtaaatttttgtttttgtttttggtccctgcaaaatattt 41739029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #142
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 548
Target Start/End: Original strand, 48609234 - 48609292
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  |||| ||||||||| ||||||||||||||||| |||||    
48609234 aaggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgt 48609292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #143
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 49073689 - 49073739
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||||| ||| |||||||||| |||||||||||||||    
49073689 aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta 49073739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #144
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 4323829 - 4323878
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||  |||||||||||||||||||||||| |||||||    
4323829 gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt 4323878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #145
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 11822366 - 11822309
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
11822366 aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgt 11822309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #146
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 13259987 - 13260044
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  || ||||||||||| ||||||||||||||||| |||||    
13259987 aggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgt 13260044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 548
Target Start/End: Complemental strand, 18900130 - 18900077
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||  |||||||||||||| ||||||||||||||||| |||||    
18900130 taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt 18900077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #148
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 24649661 - 24649604
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| |||||||||||||  ||| |||||||||||||||||||||||||||| |||||    
24649661 aggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt 24649604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 3679986 - 3679930
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||  |||||||||||||||||||||||| ||||||| |||||    
3679986 ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt 3679930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #150
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 486 - 542
Target Start/End: Original strand, 7350417 - 7350473
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||| ||||||||||||||  |||||||||||||| ||| |||||||||||||    
7350417 ttttaaggttaaaatatggttttagtccctgcaaatatgtctcattttggttttagt 7350473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #151
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 331
Target Start/End: Original strand, 15500090 - 15500289
Alignment:
129 tagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacatacaagctaatttatagaagattatgtgtg 228  Q
    |||||||||||  |||| |||| |  | ||||||||| | |||||||||||||||||  |||||| ||||  ||| | |||||||||||| || ||||||    
15500090 tagtttggtgtctagataaatgactaaagtgtccatggtgatttggtgtggtttaaacaatatgaaaacaagcaaacaaatttatagaagtttttgtgtg 15500189  T
229 tcgtggatcacaaaatatgtcggtgcaagacgaacatagaaaaaatcatgaactgaatagtttcaaattatataatttgagccctccctcaccatataaa 328  Q
    |||| || |||  ||  ||||||| |||  |   || | |||| |||||| ||| ||||| |||| ||| ||  |||||| |||||||||||||||||||    
15500190 tcgtagaccacctaaactgtcggtacaatgc---cacataaaatatcatgtacttaataggttcatattttaacatttgaaccctccctcaccatataaa 15500286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #152
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 16026571 - 16026623
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||  ||||| ||||||||||||| ||||||||||||||||||    
16026571 aaggctaaaatataattttggtccctgcaaatatccctcgttttggttttagt 16026623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #153
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 534
Target Start/End: Complemental strand, 18079662 - 18079618
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttg 534  Q
    |||||||||||||||||||  ||||||||||||||||||||||||    
18079662 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttg 18079618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #154
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 20948755 - 20948811
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| ||||| |||||||| ||||||| ||||||||| |||||    
20948755 ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgt 20948811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #155
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 540
Target Start/End: Original strand, 25658014 - 25658062
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||| |||| ||||||||| |||||||||||||||    
25658014 ggctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta 25658062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #156
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||  ||||||||||||||||||||||| |||||||| ||||    
31258699 taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg 31258647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #157
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 498 - 542
Target Start/End: Original strand, 32035442 - 32035486
Alignment:
498 aatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| ||||||||||| |||||||||||||||||    
32035442 aatatggttttgatctctgcaaatatgtctcgttttggttttagt 32035486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #158
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 494 - 542
Target Start/End: Complemental strand, 48730615 - 48730567
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||| ||| ||||||||||||||||||| ||||||||    
48730615 ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagt 48730567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #159
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 7350733 - 7350686
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| || |||||||||| ||||||||||||||||||    
7350733 taaaatatggttttggtcactgcaaatatacctcgttttggttttagt 7350686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #160
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 486 - 588
Target Start/End: Original strand, 7867123 - 7867225
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||| ||||||||||||||||||  ||| |||||||||| |||||||| |||||||| |||||         || ||||||| |||||||||||| ||||    
7867123 tttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaaattttttttgttgttttcggtccctgcaaattatt 7867222  T
586 ttg 588  Q
    |||    
7867223 ttg 7867225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #161
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||  || |||||||||||| |||||||||||||||| ||||    
12158690 ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg 12158745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #162
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 22674202 - 22674253
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||| | ||| |||||||||| |||||||||||||||||    
22674202 aggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagt 22674253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #163
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 22919978 - 22919927
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  || |||||||||||||||||||| ||||||||    
22919978 aggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagt 22919927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #164
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 26324948 - 26324897
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||| ||||  ||| ||||||||||||||||||||||||||||    
26324948 aggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagt 26324897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #165
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 27521577 - 27521632
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||  |||||||||||||| ||||||||| ||||||| |||||    
27521577 gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt 27521632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #166
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 491 - 534
Target Start/End: Original strand, 36912852 - 36912895
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttg 534  Q
    ||||||||||||||||||| |||||||||||||| |||||||||    
36912852 aggctaaaatatggttttggtccctgcaaatatgtctcgttttg 36912895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #167
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 548
Target Start/End: Original strand, 39303675 - 39303730
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||  ||||||||| |||| ||||||||||||||||| |||||    
39303675 gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgt 39303730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #168
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 488 - 547
Target Start/End: Original strand, 39747470 - 39747528
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||| ||| |||||||| | ||||||||||||||||| ||||    
39747470 ttaaggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg 39747528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #169
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 492 - 547
Target Start/End: Complemental strand, 40718474 - 40718419
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| ||||||||||||||| | |||||| ||||||| ||||    
40718474 ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg 40718419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #170
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||| ||||||||||||||  ||||||| ||||||||    
24510308 ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt 24510258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #171
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 489 - 539
Target Start/End: Original strand, 39025106 - 39025156
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||| ||||||||||||||| |||||||||||||| ||||||||| ||||    
39025106 taaggttaaaatatggttttggtccctgcaaatatgtctcgttttgatttt 39025156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #172
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 494 - 548
Target Start/End: Complemental strand, 45368847 - 45368793
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||| ||||  || ||||||||||||||||||||||||||||| |||||    
45368847 ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgt 45368793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #173
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 4565337 - 4565280
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||| || |||||||||||||| ||||||||  ||||||| |||||    
4565337 aggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgt 4565280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #174
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 15334916 - 15334965
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||| ||| ||| ||||||| |||||||||||||||    
15334916 aggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta 15334965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #175
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 489 - 542
Target Start/End: Original strand, 16083044 - 16083097
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||  |||| ||||||||| |||||||| ||||||||    
16083044 taaggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagt 16083097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #176
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 21383103 - 21383160
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| ||||  ||||||| |||||| ||||||||||||||||| |||||    
21383103 aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt 21383160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #177
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 21383429 - 21383372
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||| |||| |||||||||||||| ||||| ||||||| |||||    
21383429 aggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgt 21383372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 26062260 - 26062203
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||| ||||||||||||||  |||||| ||||||| ||| ||||||||||||||||||    
26062260 aaggttaaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctg 26062203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 493 - 534
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttg 534  Q
    |||||||||||||||| ||||||||||||||||||| |||||    
26142671 gctaaaatatggttttaatccctgcaaatatgcctcattttg 26142630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 490 - 539
Target Start/End: Original strand, 34002633 - 34002682
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||||||| |||| ||||| |||||||||||||| ||||||||||||||    
34002633 aaggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt 34002682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #181
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 495 - 548
Target Start/End: Original strand, 34808200 - 34808253
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||  ||||| |||||||| ||||||||||||||||| |||||    
34808200 taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgt 34808253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #182
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 49923819 - 49923762
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||| ||||| || |||||||||||| |||||||| ||||||| |||||    
49923819 aggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgt 49923762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #183
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 489 - 541
Target Start/End: Complemental strand, 4360629 - 4360577
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttag 541  Q
    ||||||||||||||||||||  |||||||||||||| ||||||  ||||||||    
4360629 taaggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttag 4360577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #184
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 539
Target Start/End: Complemental strand, 8364917 - 8364869
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    |||||||||||| |||||| |||| ||||||||| ||||||||||||||    
8364917 aggctaaaatatagttttggtccccgcaaatatgtctcgttttggtttt 8364869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #185
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 21391376 - 21391324
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||  |||||| |||||||||||||||| ||||||||    
21391376 aaggttaaaatatggttttagtccctgtaaatatgcctcgttttagttttagt 21391324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #186
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 491 - 539
Target Start/End: Original strand, 33067347 - 33067395
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||||||||||||||||  ||| |||||||||| ||||||||||||||    
33067347 aggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt 33067395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #187
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 103 - 226
Target Start/End: Original strand, 11896310 - 11896432
Alignment:
103 tttcccccgttgtggtatatttcacttagtttggtgttcagatcaatgcccgaggtgtccatgattatttggtgtggtttaaaacatatgataacataca 202  Q
    |||||||| |||| ||| | | || |||||||||||| ||||||||||   || |||| |||||||||||||||||||||| | || |||| ||||  ||    
11896310 tttcccccattgtagtaaactacagttagtttggtgt-cagatcaatgattgaagtgttcatgattatttggtgtggtttatagcaaatgaaaacaagca 11896408  T
203 agctaatttatagaagattatgtg 226  Q
      | |||||||||||| |||||||    
11896409 caccaatttatagaagtttatgtg 11896432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #188
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 26142419 - 26142470
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||| |||||  || | |||||||||||||||||||||||||||    
26142419 aggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagt 26142470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #189
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 491 - 542
Target Start/End: Complemental strand, 26699607 - 26699557
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| ||| ||||||||||| ||||||| ||||||||    
26699607 aggctaaaatatggttttggtcc-tgcaaatatgcttcgtttttgttttagt 26699557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #190
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 493 - 548
Target Start/End: Complemental strand, 33067729 - 33067674
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||| |||||  ||| |||||||||| ||||||||||||||| |||||||    
33067729 gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctgt 33067674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #191
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 33380257 - 33380206
Alignment:
492 ggctaaaatatggtttt-gatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||| |  |||| ||||||||||||||||||||||||||    
33380257 ggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagt 33380206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #192
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Complemental strand, 7350663 - 7350629
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||| |||||||||||||||||||||||||||||    
7350663 ttttggtccctgcaaatatgcctcgttttggtttt 7350629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #193
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 488 - 542
Target Start/End: Original strand, 20756015 - 20756069
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||| ||||||||| |||| |||| || ||||||| |||||||||||||||||    
20756015 ttaaggttaaaatatgattttaatccttgtaaatatgtctcgttttggttttagt 20756069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #194
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||| |||||||||||||||||||||||||||||    
28507188 ttttggtccctgcaaatatgcctcgttttggtttt 28507222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #195
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 491 - 533
Target Start/End: Complemental strand, 32035789 - 32035747
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgtttt 533  Q
    ||||||||||||||||||| |||||||||||||| || |||||    
32035789 aggctaaaatatggttttggtccctgcaaatatgtcttgtttt 32035747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #196
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 50428872 - 50428969
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||  ||| |||||||||| ||||||||| ||||| | |||||         |  |||||||||||||||||||||| |||||    
50428872 aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgtaaaaaaatatatttgtttttggtccctgcaaaattttttg 50428969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #197
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 501 - 542
Target Start/End: Original strand, 292868 - 292909
Alignment:
501 atggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||  |||||||||||||||||||||||| |||||||    
292868 atggttttagtccctgcaaatatgcctcgttttgcttttagt 292909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #198
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 497 - 542
Target Start/End: Complemental strand, 16083394 - 16083349
Alignment:
497 aaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||  ||||||||||||| |||||||||| |||||||    
16083394 aaatatggttttagtccctgcaaatatacctcgttttgattttagt 16083349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #199
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 511 - 548
Target Start/End: Original strand, 18302072 - 18302109
Alignment:
511 tccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||| ||||||||||||||||| |||||    
18302072 tccctgcaaatatgtctcgttttggttttagtccctgt 18302109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #200
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 493 - 542
Target Start/End: Original strand, 34382948 - 34382996
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||  ||||||||||||| ||||| ||||||||||||    
34382948 gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagt 34382996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 55; Significance: 3e-22; HSPs: 2)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 82707 - 82610
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||         || ||||||||||||| ||||||||||||||    
82707 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattttg 82610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 82335 - 82396
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||||| |||||||||||| | ||||||||||||||||| ||||    
82335 ttttaaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg 82396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 55; Significance: 3e-22; HSPs: 2)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 491 - 588
Target Start/End: Original strand, 75358 - 75455
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||||||||||||||||||||||    
75358 aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattttg 75455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 491 - 547
Target Start/End: Complemental strand, 75765 - 75709
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
75765 aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg 75709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 51; Significance: 9e-20; HSPs: 2)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 491 - 588
Target Start/End: Complemental strand, 27365 - 27268
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || ||||||||| ||||||||||||||||||    
27365 aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttgatccctgcaaaatattttg 27268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160; HSP #2
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 505 - 539
Target Start/End: Original strand, 27072 - 27106
Alignment:
505 ttttgatccctgcaaatatgcctcgttttggtttt 539  Q
    ||||| |||||||||||||||||||||||||||||    
27072 ttttggtccctgcaaatatgcctcgttttggtttt 27106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 50; Significance: 3e-19; HSPs: 2)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 487 - 548
Target Start/End: Complemental strand, 366278 - 366217
Alignment:
487 tttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
366278 tttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 366217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 365979 - 366035
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||    
365979 ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgt 366035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056 (Bit Score: 49; Significance: 1e-18; HSPs: 3)
Name: scaffold0056
Description:

Target: scaffold0056; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 490 - 585
Target Start/End: Original strand, 54813 - 54908
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||  ||| |||||||||||||||||||||||||||| |||||         || |||||||||||||||||||||||||    
54813 aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt 54908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
50075 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 50023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 495 - 547
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
55176 taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 55124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001 (Bit Score: 48; Significance: 5e-18; HSPs: 1)
Name: scaffold1001
Description:

Target: scaffold1001; HSP #1
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 489 - 548
Target Start/End: Original strand, 2775 - 2834
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
2775 taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 2834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176 (Bit Score: 48; Significance: 5e-18; HSPs: 2)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 486 - 588
Target Start/End: Complemental strand, 22061 - 21959
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatt 585  Q
    |||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||| | |||         || ||||||||| |||||||||||||||    
22061 ttttaaggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgtaatttttttttgttgtttttgatccctgcaaaatatt 21962  T
586 ttg 588  Q
    |||    
21961 ttg 21959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 524
Target Start/End: Original strand, 21694 - 21728
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatg 524  Q
    |||||||||||||||||||||||||||||||||||    
21694 aaggctaaaatatggttttgatccctgcaaatatg 21728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373 (Bit Score: 46; Significance: 8e-17; HSPs: 1)
Name: scaffold0373
Description:

Target: scaffold0373; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 486 - 547
Target Start/End: Original strand, 8541 - 8602
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||| ||||  |||||||||||||||||||||||||||||||| ||||    
8541 ttttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg 8602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 46; Significance: 8e-17; HSPs: 2)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 14696 - 14753
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
14696 aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 14753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 15013 - 14956
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| ||| ||||||||||||| |||||    
15013 aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt 14956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 46; Significance: 8e-17; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 3292 - 3235
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||    
3292 aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt 3235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 46; Significance: 8e-17; HSPs: 3)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 47923 - 47980
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||    
47923 aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg 47980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 495 - 542
Target Start/End: Complemental strand, 48228 - 48181
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||| |||||||||||||||||| |||||||||||||    
48228 taaaatatggttttggtccctgcaaatatgcctcattttggttttagt 48181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 485 - 542
Target Start/End: Complemental strand, 223179 - 223122
Alignment:
485 gttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||| ||||||||||||||||||| |||||||||||||| |||  ||||||||||||    
223179 gtttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagt 223122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 46; Significance: 8e-17; HSPs: 2)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 492 - 588
Target Start/End: Complemental strand, 148282 - 148186
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||         || || ||||||||||| |||||||||||||    
148282 ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttttttttggtcccagcaaaatattttg 148186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 147888 - 147937
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||| |||||||||||||  |||||||| ||||||||    
147888 aaggctaaaatatggttttg-tccctgcaaatat--ctcgttttagttttagt 147937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0684
Description:

Target: scaffold0684; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 486 - 542
Target Start/End: Complemental strand, 2666 - 2610
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||    
2666 tttttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagt 2610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 2333 - 2382
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||| |||||||||||| ||||||||||||| ||| ||||||||||||    
2333 aggctataatatggttttggtccctgcaaatattccttgttttggtttta 2382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0535
Description:

Target: scaffold0535; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 9028 - 8972
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
9028 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 8972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 494 - 548
Target Start/End: Original strand, 8734 - 8788
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||| |||||    
8734 ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt 8788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326 (Bit Score: 45; Significance: 3e-16; HSPs: 4)
Name: scaffold0326
Description:

Target: scaffold0326; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 4290 - 4238
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
4290 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 4238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 19472 - 19420
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
19472 aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt 19420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 4040 - 4091
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
4040 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 4091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 19222 - 19273
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||  |||||||||||||| |||||||||||||||||    
19222 aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 19273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 491 - 542
Target Start/End: Original strand, 2500 - 2551
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||||||||||||||||||||||||||| |||||||| |||||||    
2500 aggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagt 2551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 492 - 534
Target Start/End: Complemental strand, 2883 - 2841
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttg 534  Q
    |||||||||||||||||| |||||||||||||| |||||||||    
2883 ggctaaaatatggttttggtccctgcaaatatgtctcgttttg 2841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0712 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0712
Description:

Target: scaffold0712; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 5207 - 5257
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||    
5207 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 5257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0709 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0709
Description:

Target: scaffold0709; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 540
Target Start/End: Original strand, 5227 - 5277
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||    
5227 aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta 5277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0370 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0370
Description:

Target: scaffold0370; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 489 - 547
Target Start/End: Complemental strand, 292 - 234
Alignment:
489 taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
292 taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 3920 - 3862
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||||  ||||||||||||||| |||||||||||||||| |||||    
3920 aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt 3862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 3532 - 3582
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||    
3532 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 3582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0811
Description:

Target: scaffold0811; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 1309 - 1366
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||||| ||||    
1309 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg 1366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 490 - 547
Target Start/End: Complemental strand, 1646 - 1589
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||||||  |||  |||||||||||||||||||||||||||||||| ||||    
1646 aaggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg 1589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 35085 - 35028
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||||||| | |||||||| ||||||||||||||||| |||||    
35085 aggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgt 35028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 495 - 587
Target Start/End: Original strand, 34724 - 34816
Alignment:
495 taaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    ||||||||||||||| | ||||||||||||| || ||||| ||||| |||||||         || |||||||||||||||||||||||||||    
34724 taaaatatggttttgtttcctgcaaatatgcttcattttgattttaattcctgtaatttttttttgttgtttttggtccctgcaaaatatttt 34816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 492 - 588
Target Start/End: Original strand, 12182 - 12278
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatattttg 588  Q
    |||||||||||||||||  ||||||||||||||||||||||| |||||||| |||||          | |||||||||||||||||||||| |||||    
12182 ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaattttttg 12278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 12536 - 12486
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||| ||||  ||||||||||||||||||||||||||||||||    
12536 ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt 12486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 548
Target Start/End: Complemental strand, 10516 - 10459
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  |||||||||||||| || ||||||||||||||||||||    
10516 aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt 10459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 10168 - 10218
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  ||||||||||||||||| ||||||||||||||    
10168 ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt 10218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 3)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 491 - 544
Target Start/End: Original strand, 189328 - 189381
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttc 544  Q
    |||||||||||| |||||||| |||| |||||||||||||||||||||||||||    
189328 aggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagttc 189381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 490 - 540
Target Start/End: Complemental strand, 189680 - 189630
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||| |||||  || ||||||||||||||| |||||||||||    
189680 aaggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta 189630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 490 - 547
Target Start/End: Original strand, 61630 - 61687
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||| ||| |||||||||||||||   |||||| ||||||| ||||    
61630 aaggctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccctg 61687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 2)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 5397 - 5449
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  ||||||||||||||||| ||||||||||||||    
5397 aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt 5449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 488 - 547
Target Start/End: Complemental strand, 5712 - 5653
Alignment:
488 ttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||||||||||  |||||||||||||| || |||||||||||||| ||||    
5712 ttaaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg 5653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 492 - 547
Target Start/End: Original strand, 34931 - 34986
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    |||||||||||||| ||  |||||||||||||||||||||||||||||||| ||||    
34931 ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg 34986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 39; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 538
Target Start/End: Complemental strand, 4312 - 4266
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttt 538  Q
    |||||||||||||||||  ||||||||||||||||||||||||||||    
4312 ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt 4266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347; HSP #2
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 499 - 547
Target Start/End: Original strand, 4016 - 4064
Alignment:
499 atatggttttgatccctgcaaatatgcctcgttttggttttagttcctg 547  Q
    ||||||||||  ||||| |||||||||||||||||||||||||| ||||    
4016 atatggttttagtccctacaaatatgcctcgttttggttttagtccctg 4064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0337 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0337
Description:

Target: scaffold0337; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 492 - 542
Target Start/End: Original strand, 12525 - 12575
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||  |||||||||||||| |||||||||||||||||    
12525 ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 12575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 486 - 548
Target Start/End: Complemental strand, 18049 - 17987
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||||||  ||||||| ||||||||||||||||| |||||| |||||    
18049 tttttaggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgt 17987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 39; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 491 - 580
Target Start/End: Original strand, 94056 - 94145
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaa 580  Q
    ||||||||||||||||||  ||||| |||||||||||||||||||||||| | |||||         || ||||||||||||||||||||    
94056 aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaaatttttgtttttgtttttggtccctgcaaa 94145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 493 - 540
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
493 gctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||  ||||| ||||||||||||||||||||||||    
94329 gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta 94282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0166
Description:

Target: scaffold0166; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 548
Target Start/End: Original strand, 24371 - 24428
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    ||||||||||||||||||  || ||||||||||| ||||||||||||||||| |||||    
24371 aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt 24428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078 (Bit Score: 38; Significance: 0.000000000005; HSPs: 2)
Name: scaffold0078
Description:

Target: scaffold0078; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 540
Target Start/End: Original strand, 3751 - 3800
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||||||||| ||||||||||||||| | ||||||||||||    
3751 aggctaaaatatggttttggtccctgcaaatatgctttgttttggtttta 3800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 491 - 587
Target Start/End: Complemental strand, 4080 - 3984
Alignment:
491 aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgtnnnnnnnnnttattgtttttggtccctgcaaaatatttt 587  Q
    ||||||||||| ||||||| |||||||||||||| |||||||| ||||||||  || |         || |||||||||||||||||||||||||||    
4080 aggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtctctatgaaaattttttgttgtttttggtccctgcaaaatatttt 3984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Original strand, 16724 - 16780
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||| ||||| |||||||||||||  ||||||||||||||||| |||||    
16724 ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgt 16780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 492 - 548
Target Start/End: Complemental strand, 17966 - 17910
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||||||||||||||||  |||||||||||||||||||||| ||||| ||| |||||    
17966 ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt 17910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Original strand, 8328 - 8380
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| |||||||    
8328 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 8380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 490 - 542
Target Start/End: Complemental strand, 8644 - 8592
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    |||||||||||||||||||  |||||||||||||| ||||||||| |||||||    
8644 aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 8592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0578 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0578
Description:

Target: scaffold0578; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 490 - 548
Target Start/End: Complemental strand, 5072 - 5014
Alignment:
490 aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcctgt 548  Q
    |||| ||||||||||||||| || ||||||||||  |||||||||||||||||| ||||    
5072 aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagtttctgt 5014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0472 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0472
Description:

Target: scaffold0472; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 486 - 540
Target Start/End: Complemental strand, 7270 - 7216
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    |||||||||||||||||| ||||| || ||||||||||| || ||||||||||||    
7270 ttttaaggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta 7216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0204 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0204
Description:

Target: scaffold0204; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 494 - 546
Target Start/End: Original strand, 17126 - 17178
Alignment:
494 ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagttcct 546  Q
    |||||||||||||||| ||||| ||||||||  | ||||||||||||||||||    
17126 ctaaaatatggttttggtccctccaaatatgtttggttttggttttagttcct 17178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 492 - 540
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta 540  Q
    ||||||||||||| |||| ||||||||||||||| || |||||||||||    
44206 ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta 44158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0339 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0339
Description:

Target: scaffold0339; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 492 - 542
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
492 ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt 542  Q
    ||||||||||| |||||  | |||||||||||| |||||||||||||||||    
3455 ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 3405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0562 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0562
Description:

Target: scaffold0562; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 486 - 523
Target Start/End: Original strand, 9916 - 9953
Alignment:
486 ttttaaggctaaaatatggttttgatccctgcaaatat 523  Q
    |||| ||||||||||||| |||||||||||||||||||    
9916 tttttaggctaaaatatgcttttgatccctgcaaatat 9953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University