View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4920-Insertion-6 (Length: 95)
Name: NF4920-Insertion-6
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4920-Insertion-6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 95
Target Start/End: Original strand, 34055578 - 34055665
Alignment:
| Q |
8 |
tattcatcctagagttgtggctcctatttacttaagagatggaatttgtggcaagttcagcatatgcaaaaccatatatatgtcttcg |
95 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34055578 |
tattcatcctagtgttgtggctcctatttacttaagagatggaatttgtggcaagttcagcatatgcaaaaccatatatatgtcttcg |
34055665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.000000000000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.000000000000008
Query Start/End: Original strand, 32 - 88
Target Start/End: Complemental strand, 47381229 - 47381173
Alignment:
| Q |
32 |
tatttacttaagagatggaatttgtggcaagttcagcatatgcaaaaccatatatat |
88 |
Q |
| |
|
||||||||||||||||| || ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
47381229 |
tatttacttaagagatgaaagttgtggcaaattcagcatatgcacaaccatatatat |
47381173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 32 - 94
Target Start/End: Complemental strand, 47816694 - 47816634
Alignment:
| Q |
32 |
tatttacttaagagatggaatttgtggcaagttcagcatatgcaaaaccatatatatgtcttc |
94 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||| | | |||||||||||||||| |
|
|
| T |
47816694 |
tatttacttaagagatggaagttgtggcaagctgagcatat--acagccatatatatgtcttc |
47816634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University