View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4920-Insertion-8 (Length: 159)
Name: NF4920-Insertion-8
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4920-Insertion-8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 8 - 159
Target Start/End: Original strand, 48749048 - 48749199
Alignment:
| Q |
8 |
acaacatcttcaactagttactcatcattagcaccttcgtccacagcttcaatgatgaatcactcatcatggcactcaccaattccttacctttttggag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48749048 |
acaacatcttcaactagttactcatcattagcaccttcatccacagcttcaatgatgaatcactcatcatggcactcaccaattccttacctttttggag |
48749147 |
T |
|
| Q |
108 |
gcttagcagccatgttaggtctcatagcttttgcactgttaattttagcttg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48749148 |
gcttagcagccatgttaggtctcatagcttttgcactgttaattttagcttg |
48749199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 68 - 150
Target Start/End: Complemental strand, 53701452 - 53701370
Alignment:
| Q |
68 |
cactcatcatggcactcaccaattccttacctttttggaggcttagcagccatgttaggtctcatagcttttgcactgttaat |
150 |
Q |
| |
|
|||||| ||||||| |||||| |||| ||| | || || || |||||||||||||||||| | ||||||||||| || ||||| |
|
|
| T |
53701452 |
cactcaccatggcattcaccagttccatacttgttcggtggtttagcagccatgttaggtttaatagcttttgctctattaat |
53701370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University