View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4920_high_17 (Length: 235)
Name: NF4920_high_17
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4920_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 217
Target Start/End: Complemental strand, 23408900 - 23408709
Alignment:
| Q |
22 |
agctaaattgataccagagagaattgaacctaaaacctagagaagaagcacacttgtaaatcccaaaccactaccctttaacaaactatttattacacaa |
121 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
23408900 |
agctaaatttataccagagagaattgaacctaaaacctagaggagaagcatacttgtagatcccaaaccaataccctttaaccaactatttattacacaa |
23408801 |
T |
|
| Q |
122 |
caagaggcataggatagtactggtggcgaggacatgggaggcatgtcatccgcgaggatgaatgatacgtaaaagattattattctctattatagg |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23408800 |
caagaggcataggatagt----gtggcgaggacatgggaggcatgtcatccgcgaggatgaatgatacgtaaaagattattattctctattatagg |
23408709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 75
Target Start/End: Complemental strand, 29210452 - 29210401
Alignment:
| Q |
24 |
ctaaattgataccagagagaattgaacctaaaacctagagaagaagcacact |
75 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| ||| || |||||||| |
|
|
| T |
29210452 |
ctaaattgataccagagagaattgaacttgaaacctcgaggaggagcacact |
29210401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 87
Target Start/End: Complemental strand, 7973648 - 7973587
Alignment:
| Q |
26 |
aaattgataccagagagaattgaacctaaaacctagagaagaagcacacttgtaaatcccaa |
87 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||| ||||| | ||||||| |||||||||| |
|
|
| T |
7973648 |
aaattgacatcagagagaatcgaacctaaaaccttaagaaggaacacacttctaaatcccaa |
7973587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University