View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4920_high_18 (Length: 230)
Name: NF4920_high_18
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4920_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 3 - 145
Target Start/End: Original strand, 1733607 - 1733749
Alignment:
| Q |
3 |
tcaatttgttcaaccgattgagtgataactcccgatcattttttggtgtgtaaaccatgatccgttggtaacttttgatgaccnnnnnnnagaattctaa |
102 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
1733607 |
tcaatttgttcaaccgattgagttataactcccgatcattttttggtgtgtaaaccatgatctattggtaacttttgataaccttattttagaattctaa |
1733706 |
T |
|
| Q |
103 |
gcaattttgtgggatttattgagcaaccatcgaaagatattgg |
145 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1733707 |
gcaattttgtgggatctattgagcaaccatcgaaagatattgg |
1733749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University