View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4920_high_4 (Length: 411)
Name: NF4920_high_4
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4920_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 37362415 - 37362184
Alignment:
| Q |
1 |
cattttgattaaacatcttcaatcgccggctgaaaacaactctgttcaggagctgtcaccgtttgaacatgaggttgagaaagggagtgatttcgcactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
37362415 |
cattttgattaaacatcttcaatcgccggctgaaaacaattctgttgaggagctgttaccgtttgaacatgaggttgagaaagggagcgctttcgcactt |
37362316 |
T |
|
| Q |
101 |
ggacttcttgatgttaaggtaacttcacttccaccttttctctattccatcattgttcatatttgtttattttatgaattttctctcaaggttatcgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37362315 |
ggacttcttgatgttaaggtaacttcacttccaccttttctctattccatcattgttcatatttgtttattttatgaattttctctcaaggttatcgttt |
37362216 |
T |
|
| Q |
201 |
tatctagattctaattgttatcatcctctctc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37362215 |
tatctagattctaattgttatcatcctctctc |
37362184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 4 - 131
Target Start/End: Complemental strand, 684311 - 684184
Alignment:
| Q |
4 |
tttgattaaacatcttcaatcgccggctgaaaacaactctgttcaggagctgtcaccgtttgaacatgaggttgagaaagggagtgatttcgcacttgga |
103 |
Q |
| |
|
||||||||| ||||||||| | ||| || |||| | |||||||| ||| || ||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
684311 |
tttgattaagcatcttcaaccaccgactcaaaatgattctgttcaaaagccgttgccgtttgaacatgaggttgagaaagggagtgctttcgcgcttgga |
684212 |
T |
|
| Q |
104 |
cttcttgatgttaaggtaacttcacttc |
131 |
Q |
| |
|
||||||| ||| ||||||| |||||||| |
|
|
| T |
684211 |
cttcttgctgtcaaggtaatttcacttc |
684184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 201
Target Start/End: Original strand, 7135542 - 7135603
Alignment:
| Q |
140 |
ctctattccatcattgttcatatttgtttattttatgaattttctctcaaggttatcgtttt |
201 |
Q |
| |
|
|||||||||||| ||||||| ||||||| ||||| |||||||||||||||||| || ||||| |
|
|
| T |
7135542 |
ctctattccatcgttgttcagatttgttgattttgtgaattttctctcaaggtaatagtttt |
7135603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 143 - 202
Target Start/End: Original strand, 17831490 - 17831549
Alignment:
| Q |
143 |
tattccatcattgttcatatttgtttattttatgaattttctctcaaggttatcgtttta |
202 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||| |||||||||||||||||| || |||||| |
|
|
| T |
17831490 |
tattccatcgttgttcagatttgttgattttgtgaattttctctcaaggtaatagtttta |
17831549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University