View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4920_low_14 (Length: 241)
Name: NF4920_low_14
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4920_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 1733110 - 1733345
Alignment:
| Q |
10 |
atgtggattaagtgctagagaatcaaaacaatgttatagaagctaatatatagttcattattattttgnnnnnnngagattagtttgaaagcataagctt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
1733110 |
atgtggattaagtgctagagaatcaaaacaatgttatagaagctaatatatagttcattattattttgtttttttgagattagtttgaaagcataagcct |
1733209 |
T |
 |
| Q |
110 |
agtcaagacaagattttgatctaaaaactcaaaggacaaaatagggttccaaaatg----nnnnnnnnnnncttgtcttctatcaaccaaattggacttg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| ||||||| |
|
|
| T |
1733210 |
agtcaagacaagattttgatctaaaaactcaaaggacaaaatagggttccaaaatgttttttttttgtgttcttgtcttatatcaaccaaataggacttg |
1733309 |
T |
 |
| Q |
206 |
aacttactgtttctacaactatgtaattaaattggt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1733310 |
aacttactgtttctacaactatgtaattaaattggt |
1733345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University