View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4920_low_2 (Length: 476)
Name: NF4920_low_2
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4920_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 444; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 444; E-Value: 0
Query Start/End: Original strand, 20 - 467
Target Start/End: Complemental strand, 48961626 - 48961179
Alignment:
| Q |
20 |
aagacgcactcctggatcatgatgggagcaagaagcatgatacagtagagagttattgacacactgtacattgctgttcatgtatgcagccattggaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961626 |
aagacgcactcctggatcatgatgggagcaagaagcatgatacagtagagagttattgacacactgtacattgctgttcatgtatgcagccattggaatt |
48961527 |
T |
|
| Q |
120 |
gaagattttgttcttcctttgttattcttatctttcttgtttatttttccttcatcagcacttgaactctcagattcaccaccatcaactttgattgtgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48961526 |
gaagattttgttcttcctttgttattcttatctttcttgtttatttttccttcatcagcacttgaactctcagattcaccaccgtcaactttgattgtgt |
48961427 |
T |
|
| Q |
220 |
tccccttcttgtgaagataattgggttggtgtttcttttgggattgaactagttccatataggctcctctgttttcccctgcaattgttatcactctcat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961426 |
tccccttcttgtgaagataattgggttggtgtttcttttgggattgaactagttccatataggctcctctgttttcccctgcaattgttatcactctcat |
48961327 |
T |
|
| Q |
320 |
gccagagtcctcagaatctgaaaactttttctccttgctggattctcttcctttcacagtaatgtgttttccatgatgggaagaattgctgtgattttga |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961326 |
gccagagtcctcagaatctgaaaactttttctccttgctggattctcttcctttcacagtaatgtgttttccatgatgggaagaattgctgtgattttga |
48961227 |
T |
|
| Q |
420 |
gtctgcctatggaattcaccattgctgtgattttgattctccctatgc |
467 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961226 |
gtctgcctatggaattcaccattgctgtgattttgattctccctatgc |
48961179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University