View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4920_low_23 (Length: 208)
Name: NF4920_low_23
Description: NF4920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4920_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 23408876 - 23408709
Alignment:
| Q |
19 |
tgaacctaaaacctagagaagaagcacacttgtaaatcccaaaccactaccctttaacaaactatttattacacaacaagaggcataggatagtactggt |
118 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
23408876 |
tgaacctaaaacctagaggagaagcatacttgtagatcccaaaccaataccctttaaccaactatttattacacaacaagaggcataggatagt----gt |
23408781 |
T |
|
| Q |
119 |
ggcgaggacatgggaggcatgtcatccgcgaggatgaatgatacgtaaaagattattattctctattatagg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23408780 |
ggcgaggacatgggaggcatgtcatccgcgaggatgaatgatacgtaaaagattattattctctattatagg |
23408709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University