View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4921_low_1 (Length: 250)
Name: NF4921_low_1
Description: NF4921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4921_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 11679852 - 11680085
Alignment:
| Q |
1 |
tccattcgaaaccctaattctctctctcaccagcggacagacagacggagtttcgttcatcgattcgcgatggctccaatgacaaataagaatcctgcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
11679852 |
tccattcgaaaccctaattctctctctcaccagcggacagacagacggagtttcgttcatccattcgcgatggcttcaatgacaaataagaaccctgcag |
11679951 |
T |
|
| Q |
101 |
gctcgaagaggttcaagttcaatgcgtacatctaccaggttctgaagcaggtgcaccctggcattcatattttcttgcggagcgttgaaaagcatgaata |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11679952 |
gctcgaagaggttcaagttcaatgagtacatctaccaggttctgaagcaggtgcaccatggcattcatattttcttgcggagcgttgaaaagcatgaata |
11680051 |
T |
|
| Q |
201 |
gtatcataaccaacttgatggtgacgcttgttca |
234 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |
|
|
| T |
11680052 |
gtatcataaccaacatgatggtgaagcttgttca |
11680085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University