View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4923_high_15 (Length: 251)
Name: NF4923_high_15
Description: NF4923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4923_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 42242265 - 42242030
Alignment:
| Q |
1 |
aatggcatggcacggaaactaaccaagaaaatggttacattgaaatcatattaattgaatctttgcgacaaacatgtggaattatttgaattttgcaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42242265 |
aatggcatggcacggaaactaaccaagaaaatggttacattgaaatcatattaattgaatctttgcgacaaacatgtggaattatttgaattttgcaagc |
42242166 |
T |
|
| Q |
101 |
aataaaaagtatggtccacggtgctagattgaatggattgtggatgcctctggcgggagacctaannnnnnnnnnnnnnnnaaggagacctaattgaaaa |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42242165 |
aataaaaagtatggaccacggtgctagattgaatggattgtggatgcctctggcgggagacctaatttatttttattttttaaggagacctaattgaaaa |
42242066 |
T |
|
| Q |
201 |
gacaaacacatgggtccaatgcccctttattcctag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42242065 |
gacaaacacatgggtccaatgcccctttattcctag |
42242030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University