View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4923_high_18 (Length: 234)

Name: NF4923_high_18
Description: NF4923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4923_high_18
NF4923_high_18
[»] chr7 (1 HSPs)
chr7 (34-222)||(44782697-44782885)


Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 34 - 222
Target Start/End: Complemental strand, 44782885 - 44782697
Alignment:
34 attgtatatcattttatattagaaaacacgttgaatgaatattttatatggagctactcatcttgataaccaaaaacatgtgtcttttactaacatattc 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44782885 attgtatatcattttatattagaaaacacgttgaatgaatattttatatggagctactcatcttgataaccaaaaacatgtgtcttttactaacatattc 44782786  T
134 aacattatgtacatgccttgttgaagtagttagtgataccagttaatataaatttgagataactacatgggagaatatatttttgtcat 222  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44782785 aacactatgtacatgccttgttgaagtagttagtgataccagttaatataaatttgagataactacatgggagaatatatttttgtcat 44782697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University