View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4923_high_5 (Length: 333)
Name: NF4923_high_5
Description: NF4923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4923_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 59 - 317
Target Start/End: Original strand, 42245988 - 42246246
Alignment:
| Q |
59 |
accaaaatttacagttacatttgttgagtgcaatcaagacaagaaacccttaaatttttgtttaaatacggaaaattcagatatttaataatccaaattc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42245988 |
accaaaatttacagttacatttgttgagtgcaatcaagacaagaaacccttaaatttttgtttaaatacggaaaattcagatatttaataatccaaattc |
42246087 |
T |
 |
| Q |
159 |
caaaaactcgtgtggttaattattaaatatgtcagctcaatcaaacaaatattaacaatttctatctaaatcaactaaccccactatgccttattgggtt |
258 |
Q |
| |
|
||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42246088 |
caaaaactcatgtggttaattaatacatatgtcagctcaatcaaacaaatattaacaatttctatctaaatcaactaaccccactatgccttattgggtt |
42246187 |
T |
 |
| Q |
259 |
caaatagataatagtggtgtgcaatcatatgatcaagagccctaaacaccataattttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42246188 |
caaatagataatagtggtgtgcaatcatatgatcaagagccctaaacaccataattttt |
42246246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 206 - 297
Target Start/End: Original strand, 31071670 - 31071761
Alignment:
| Q |
206 |
aatattaacaatttctatctaaatcaactaaccccactatgccttattgggttcaaatagataatagtggtgtgcaatcatatgatcaagag |
297 |
Q |
| |
|
||||| |||||||| |||| |||||| ||||||||||||| || || | ||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
31071670 |
aatatcaacaattttcatctcaatcaattaaccccactatgtctcatgagcttcaaattggtaatagtggtgtgcaatcatatgatcaagag |
31071761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 222 - 297
Target Start/End: Original strand, 19991833 - 19991908
Alignment:
| Q |
222 |
atctaaatcaactaaccccactatgccttattgggttcaaatagataatagtggtgtgcaatcatatgatcaagag |
297 |
Q |
| |
|
|||| |||||||||||||||||||| || || |||||| || | |||| |||||||||||||| ||||||||||| |
|
|
| T |
19991833 |
atctcaatcaactaaccccactatgtctcatgaggttcatattggtaatggtggtgtgcaatcaaatgatcaagag |
19991908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 212 - 297
Target Start/End: Complemental strand, 23563084 - 23562999
Alignment:
| Q |
212 |
aacaatttctatctaaatcaactaaccccactatgccttattgggttcaaatagataatagtggtgtgcaatcatatgatcaagag |
297 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||| || || |||||| || | |||| |||||||||||||| ||||||||||| |
|
|
| T |
23563084 |
aacaattttcatctcaatcaactaaccccagtatgtctcatgaggttcatattggtaatggtggtgtgcaatcaaatgatcaagag |
23562999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 212 - 297
Target Start/End: Complemental strand, 48264763 - 48264678
Alignment:
| Q |
212 |
aacaatttctatctaaatcaactaaccccactatgccttattgggttcaaatagataatagtggtgtgcaatcatatgatcaagag |
297 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||| || || |||||| || | |||| || ||||||||||| ||||||||||| |
|
|
| T |
48264763 |
aacaattttcatctcaatcaactaaccccactatgtctcatgaggttcatattggtaatggttgtgtgcaatcaaatgatcaagag |
48264678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University