View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4923_low_10 (Length: 273)
Name: NF4923_low_10
Description: NF4923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4923_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 253
Target Start/End: Original strand, 31532591 - 31532835
Alignment:
| Q |
11 |
cacagaccaaagattaatccacatattcatgaatctttgatgaacacacacgaggacaccacaaagagaacaaacgaacaaagatctacgtggttcgaca |
110 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
31532591 |
cacacaccaaagattaatccacatatttatgaatctttgatgaacacacacgaggacaacacaaagagaacaaatgaacaaagatttacgtggttcgaca |
31532690 |
T |
 |
| Q |
111 |
cttgttatg-tacatccacata-aacatctcaatataatgtatttactatctcaaaaagtattacaatgattgtaactcaatctcggattgtgtatcaac |
208 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31532691 |
cttgttacggtacatccacatataacatctcaatataatgtatttactatctcaaaaagtattgcaatgattgtaactcaatctcggattgtgtatcaac |
31532790 |
T |
 |
| Q |
209 |
ctacaatactcttactcaagagttaaaaataatgataacactcat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31532791 |
ctacaatactcttactcaagagttaaaaataatgataacactcat |
31532835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University