View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4923_low_16 (Length: 244)
Name: NF4923_low_16
Description: NF4923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4923_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 44783165 - 44783369
Alignment:
| Q |
1 |
aatcccaaaaacaaagtaaacatcaattgtcagttcaacataggttagagactttaagataaatataaatagttaagctaaaatagcttatttcttcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44783165 |
aatcccaaaaacaaagtaaacatcaattgtcagttcaacatag-ttagagactttaagataaatataaatagttaagctaaaatagcttatttcttcata |
44783263 |
T |
 |
| Q |
101 |
aatttgatacccaaacaaaacaagatattactttttaacaagattctcgtatcagtttacacttgcaaaaaatttactataatattgatagatattgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44783264 |
aatttgatacccaaacaaaacaagatattactttttaacaagattctcgtatcagtttacacttgcaaaaaatttactataatattgatagatattgctt |
44783363 |
T |
 |
| Q |
201 |
catcag |
206 |
Q |
| |
|
|||||| |
|
|
| T |
44783364 |
catcag |
44783369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University