View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4923_low_17 (Length: 234)
Name: NF4923_low_17
Description: NF4923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4923_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 1430997 - 1431198
Alignment:
| Q |
19 |
gaacatgtgcttcggctacataccgacatgtctcaccgaatcgaggatcggtttcccctaggacctgcccttgaatttcaagacctgctgtataaaacag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430997 |
gaacatgtgcttcggctacataccgacatgtctcaccgaatcgaggatcggtttcccctaggacctgcccttgaatttcaagacctgctgtataaaacag |
1431096 |
T |
|
| Q |
119 |
tagagaattctcaatatttcccatcattgcataagtatcacctaattgcatacaccctgcaaacttagctagtgcatgatcttgaccatcctctaacaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1431097 |
tagagaattctcaatatttcccatcattgcataagtatcacctaattgcatacaccctgcaaacttagctagtgcatgatcttgaccatcctctaacaca |
1431196 |
T |
|
| Q |
219 |
gg |
220 |
Q |
| |
|
|| |
|
|
| T |
1431197 |
gg |
1431198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 208
Target Start/End: Complemental strand, 1250714 - 1250630
Alignment:
| Q |
124 |
aattctcaatatttcccatcattgcataagtatcacctaattgcatacaccctgcaaacttagctagtgcatgatcttgaccatc |
208 |
Q |
| |
|
||||||| |||||||||||||||| |||||| ||| ||||| || |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
1250714 |
aattctcgatatttcccatcattgtataagtgtcatgtaatttcacgcaccatgcaaacttagcttgtgcatgatcttgaccatc |
1250630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 1250806 - 1250721
Alignment:
| Q |
19 |
gaacatgtgcttcggctacataccgacatgtctcaccgaatcgaggatcggtttcccctaggacctgcccttgaatttcaagacct |
104 |
Q |
| |
|
|||||||||| || ||||| | | ||||||||||||||||| |||||| |||||||| | | |||| ||| |||||||||| ||| |
|
|
| T |
1250806 |
gaacatgtgcctcagctacgtgcatacatgtctcaccgaatctaggatcagtttcccccaagtcctgacctggaatttcaagtcct |
1250721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University