View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4923_low_19 (Length: 222)
Name: NF4923_low_19
Description: NF4923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4923_low_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 45167806 - 45167599
Alignment:
| Q |
19 |
tgcacaccatgttaatttgaacatatagtcccgtcttcgatacctaccataacgttaacggtgtgtctaacgaaaaataaaacaaaagtgagaaatttgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45167806 |
tgcacaccatgttaatttgaacatatagtcccgtcttcgatacctaccataacgttaacggtgtgtctaacaaaaaataaaacaaaagtgagaaatttgg |
45167707 |
T |
 |
| Q |
119 |
atctagatatattttgtataannnnnnnacaaaaaactctacttcattcatcatg----atatgacttcaaatctaaagtcataactacatcaatgccaa |
214 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45167706 |
atctagatatattttgtataatttttttacaaaaaactctacttcattcatcatgatatatatgacttcaaatctaaagtcataactacatcaatgcaaa |
45167607 |
T |
 |
| Q |
215 |
aggtagtt |
222 |
Q |
| |
|
||| |||| |
|
|
| T |
45167606 |
agggagtt |
45167599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University