View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4923_low_6 (Length: 325)
Name: NF4923_low_6
Description: NF4923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4923_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 7 - 316
Target Start/End: Complemental strand, 12225255 - 12224946
Alignment:
| Q |
7 |
tagacatggttctgttatagttgattcagttaaccgagtaatggttttaactgaattagctgcgttttattttgctggccatggcagttctgatgacaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12225255 |
tagacatggttctgttatagttgattcagttaaccgagtaatggttttaactgaattagctgcgttttattttgctggccatggcagttccgatgacaat |
12225156 |
T |
|
| Q |
107 |
gataaaatttctagctggcagaaattttcttcgaatttaccgtcaaagccgcggagcccagttcttattgaggactgggcttacgcgctttgtgaagttg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12225155 |
gataaaatttctagctggcagaaattttcgtcgaatttaccgtcaaagccacggagcccagttcttattgaggactgggcttacgcgctttgtgaagttg |
12225056 |
T |
|
| Q |
207 |
gctccccgtggaggagccaatggaaattgttttcgtgttgcttttctgcgaccacgagtgggaagtggtcgcggatagagcggcaggaatggggtgatgt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12225055 |
gctccccgtggaggagccaatggaaattgttttcgtgctgcttttctgcgaccacgagtggtaagtggtcgcggatagagcggcaggaatggggtgatgt |
12224956 |
T |
|
| Q |
307 |
ttttgatatt |
316 |
Q |
| |
|
|||||||||| |
|
|
| T |
12224955 |
ttttgatatt |
12224946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University