View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4923_low_9 (Length: 275)
Name: NF4923_low_9
Description: NF4923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4923_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 3 - 269
Target Start/End: Original strand, 55865589 - 55865855
Alignment:
| Q |
3 |
actcttcttcttgttcttctctccgttgttgttctgttctcctatgcggcggcgaggaatcaatttgcgcctggtggatggagtcccatcgatgacatca |
102 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55865589 |
actcttcttcttgttcttctcttcgttgttgttctgttctcctatgcggcggcgaggaatcaatttgcgcctggtggatggagtcccatcgatgacatca |
55865688 |
T |
 |
| Q |
103 |
acgatcctcatgtcaccgaaatcgccaatttcgccgtcactgagtatgacaggcgaagtggagcgaagctgaagttcgagaaagttatcaacggtgaatc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55865689 |
acgatcctcatgtcaccgaaatcgccaatttcgccgtcactgagtatgacaggcgaagtggagcgaagctgaagttcgagaaagttatcaacggtgaatc |
55865788 |
T |
 |
| Q |
203 |
tcaggtggttgctgggactaattaccgtctcaccctttccgctgccgatggttcctattctaagaat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55865789 |
tcaggtggttgctgggactaattaccgtctcaccctttccgcttccgatggttcctattctaagaat |
55865855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 5520811 - 5520875
Alignment:
| Q |
171 |
ctgaagttcgagaaagttatcaacggtgaatctcaggtggttgctgggactaattaccgtctcac |
235 |
Q |
| |
|
|||||||||||||| || |||| |||||||| || || ||||| |||||||| ||||||||||| |
|
|
| T |
5520811 |
ctgaagttcgagaaggtcgtcaagggtgaatcacaagttgttgcagggactaactaccgtctcac |
5520875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University