View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4924-Insertion-11 (Length: 278)
Name: NF4924-Insertion-11
Description: NF4924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4924-Insertion-11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 12 - 276
Target Start/End: Original strand, 3896105 - 3896369
Alignment:
| Q |
12 |
gtgatttgagatataaaaactacacaaatgtctttgtcccaaattctcaaaattgttaaaattggatgggataagattaataaacaaggctctcataata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3896105 |
gtgatttgagatataaaaactacacaaatgtctttgtcccaaattctcaaaattgttaaaattggatgggataagattaataaacaaggctctcataata |
3896204 |
T |
|
| Q |
112 |
tggtaacaagtgaacttccatattttgcaagagttttttaaattcagttacaatctaaaaatagatagattaaagagacatttagaagagtttatttgaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3896205 |
tggtaacaagtgaacttccatattttgcaagagttttttaaattcagttacaatctaaaaatagatagattaaagagacatttagaagagtttatttgaa |
3896304 |
T |
|
| Q |
212 |
acttatttatctcatgtaactataataacattttcataagcttcagtctattggatcgactatga |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3896305 |
acttatttatctcatgtaactataataacattttcataagcttcagtctattggaccgactatga |
3896369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University