View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4925_high_1_N (Length: 482)
Name: NF4925_high_1_N
Description: NF4925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4925_high_1_N |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-137; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 50 - 321
Target Start/End: Original strand, 23332595 - 23332866
Alignment:
| Q |
50 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
149 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
|
| Q |
150 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
|
| Q |
250 |
agctcagcccaaccatcccgcagatagaccttgccatttttcacgtggaccttgacctcgaacatgtctctg |
321 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
23332795 |
agctcagcccaaccatcccgcagataaaccttgccatttttcacgtggaccttgaccttgaacatgtttctg |
23332866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 13 - 55
Target Start/End: Original strand, 23322331 - 23322373
Alignment:
| Q |
13 |
gacatcatcaaacacaatcgttgtaaaatccaaacgcatatgt |
55 |
Q |
| |
|
||||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23322331 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 13 - 55
Target Start/End: Original strand, 23332498 - 23332540
Alignment:
| Q |
13 |
gacatcatcaaacacaatcgttgtaaaatccaaacgcatatgt |
55 |
Q |
| |
|
||||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23332498 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 69; Significance: 9e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 385 - 453
Target Start/End: Complemental strand, 8450858 - 8450790
Alignment:
| Q |
385 |
cagtcagtgatttgtgagtattaagtaacatgtaatctatttggtattgttttgaatcaatacatgttg |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8450858 |
cagtcagtgatttgtgagtattaagtaacatgtaatctatttggtattgttttgaatcaatacatgttg |
8450790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University