View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4925_low_3 (Length: 202)
Name: NF4925_low_3
Description: NF4925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4925_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 16 - 128
Target Start/End: Original strand, 42050923 - 42051032
Alignment:
| Q |
16 |
atgataggcaatcgatggtcactcttaatggttacaagttataatatcacccctcctcccgccataagttgcaccatcacatttcgattaatcccatcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42050923 |
atgataggcaatcgatggtcactcttaatggttacaagttataatatcacc---cctcccgccataagttgcaccatgacatttcgattaatcccatcat |
42051019 |
T |
 |
| Q |
116 |
ccattattttctc |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42051020 |
ccattattttctc |
42051032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University