View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4926_high_4 (Length: 364)
Name: NF4926_high_4
Description: NF4926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4926_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 86 - 279
Target Start/End: Complemental strand, 37074741 - 37074559
Alignment:
| Q |
86 |
gtgtgtctcacttaagattgaaggtaagtgagacctcgggtcttataagatcccttataagatccctttgaagatgatcttagtgtatgtctaattctgc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
37074741 |
gtgtgtctcacttaagattgaaggtaagtgagaactcgggtcttataagacccctt-----------ttgaagatggtcttagtgtatgtctaattctgc |
37074653 |
T |
 |
| Q |
186 |
agcaacaaaaatttattttaaagtgagatgattttgaaaaattgattcttactaacaatggattgaagataaaatcatttgtgtttgcatatgg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37074652 |
agcaacaaaaatttattttaaagtgagatgattttgaaaaattgattcttactaacaatggattgaagataaaatcatttgtgtttgcatatgg |
37074559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University