View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4926_low_10 (Length: 250)
Name: NF4926_low_10
Description: NF4926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4926_low_10 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 109 - 250
Target Start/End: Complemental strand, 12156100 - 12155959
Alignment:
| Q |
109 |
catcaaattatattatctcaacttaatagtaattctgtgagacacaatatcatgatggctcccacattaaagggctattaacaaacttgatttataaatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||||| || |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12156100 |
catcaaattatattatctcaacttaatagtaattatgtgggacacaatatcatgattactgccacatcaaagggctattaacaaacttgatttataaatg |
12156001 |
T |
 |
| Q |
209 |
ttggccaacactgttgttgttgaaagagccacaacctttcgt |
250 |
Q |
| |
|
|||| || |||||||| ||||||||||||||||||||||||| |
|
|
| T |
12156000 |
ttggtcagcactgttgatgttgaaagagccacaacctttcgt |
12155959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 109 - 248
Target Start/End: Original strand, 43860413 - 43860552
Alignment:
| Q |
109 |
catcaaattatattatctcaacttaatagtaattctgtgagacacaatatcatgatggctcccacattaaagggctattaacaaacttgatttataaatg |
208 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| |||| ||||| |||||||||||| |||||| ||| ||||| ||| |||||||||||||||||| |
|
|
| T |
43860413 |
catcaaattatactatctcaacttattagtaatcatgtggtgcacaagatcatgatggctgccacatcaaatggctactaataaacttgatttataaatg |
43860512 |
T |
 |
| Q |
209 |
ttggccaacactgttgttgttgaaagagccacaacctttc |
248 |
Q |
| |
|
|||| || || | || |||||||||| || ||||||||| |
|
|
| T |
43860513 |
ttggtcatcattactgatgttgaaagacccgcaacctttc |
43860552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University