View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4926_low_8 (Length: 283)
Name: NF4926_low_8
Description: NF4926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4926_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 29 - 276
Target Start/End: Original strand, 1324835 - 1325082
Alignment:
| Q |
29 |
tatatatatatgtgtgtgtgctgagtgatagcagatgtaccatattgtattgttgtacttgtaattagtgatggctcggtttgnnnnnnngtctctctta |
128 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1324835 |
tatatatatatgtgtgtgtgttgagtgatagcagatgtaccatattgtattgttgtacttgtaattagtgatggctcggtttgtttttttgtctctctta |
1324934 |
T |
|
| Q |
129 |
ttcttattcttattcttaattgatggttctaagagtgagcttcatgttggtttctactccaacacatgtcctcaagtagagtccactgtccatgatgttg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1324935 |
ttcttattcttattcttaattgatggttctaagagtcagcttcatgttggtttctactccaacacatgtcctcaagtagagtccactgtccatgatgttg |
1325034 |
T |
|
| Q |
229 |
ttagagaagctgttctttttgacagaaccaaggctgctgttcatctca |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1325035 |
ttagagaagctgttctttttgacagaaccaaggctgctgttcttctca |
1325082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University