View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4927-Insertion-10 (Length: 142)
Name: NF4927-Insertion-10
Description: NF4927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4927-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 142
Target Start/End: Complemental strand, 40080212 - 40080077
Alignment:
| Q |
8 |
ggatattcctgcgacagcgatgttgaaagctcgcttaccactgcggttaatggtgcggaggtcgagctctagacctacgaggaagagatagaagagaagg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40080212 |
ggatattcctgcgacagcgatgttgaaagctcgcttaccactgcggttaatggtgcggaggtcgagctcaagacctacgaggaagagatagaagagaagg |
40080113 |
T |
|
| Q |
108 |
cc-atgccggctacggattcacgtatgggagtgctc |
142 |
Q |
| |
|
|| |||| ||||| |||||| |||||||||||||| |
|
|
| T |
40080112 |
ccaatgctagctactgattcaagtatgggagtgctc |
40080077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University