View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4927_high_10 (Length: 325)
Name: NF4927_high_10
Description: NF4927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4927_high_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 17 - 325
Target Start/End: Complemental strand, 45349247 - 45348939
Alignment:
| Q |
17 |
acatggaagcctaatagggccatcattttgaaacccatattcaacttctgcttcatccagtaacatcttgaattttgggtgattaacaaacttggttttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45349247 |
acatggaagcctaatagggccatcattttgaaacccatattcaacttctgcttcatccagtaacatcttgaattttgggtgattaacaaacttggttttc |
45349148 |
T |
 |
| Q |
117 |
acaacaaacctttgactttgtagtccaacataaactgtaaaacaaccattgggaatttttacaattcgacccttcgcattttctgaaaatgattttgaac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45349147 |
acaacaaacctttgactttgtagtccaacataaactgtaaaacaaccattgggaatttttacaattcgacccttcgcattttctgaaaatgattttgaac |
45349048 |
T |
 |
| Q |
217 |
tactcttattcaaaagtaatgacctcatattgctattgtcacctccacgtccaaatgatcgccatgccttcaatatcttattcttcttacattttccctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45349047 |
tactcttattcaaaagtaatgacctcatattgctattgtcacctccacgtcctaatgatcgccatgccttcaatatcttattcttcttacattttccctt |
45348948 |
T |
 |
| Q |
317 |
tatattgcc |
325 |
Q |
| |
|
||||||||| |
|
|
| T |
45348947 |
tatattgcc |
45348939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University