View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4927_high_13 (Length: 260)
Name: NF4927_high_13
Description: NF4927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4927_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 5542966 - 5543192
Alignment:
| Q |
15 |
agaagcaaagaaaaaacaccctaaagaaaaacaacaatatggctagtgatggaagtgaagtgttcaagttggtgtcaccagcaatagcaaacgaaggaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5542966 |
agaagcaaagaaaaaacaccctaaagaaaaacaacaatatggctagtgatggaagtgaagtgttcaagttggtgtcaccagcaatagcaaacgaaggaaa |
5543065 |
T |
 |
| Q |
115 |
actaccaagacaattcactgatgaaggacaaggagcaaagaaaaacatatcaccaccattggaatggtacaacatacctgaggggacaaaatctcttgca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
5543066 |
actaccaagacaattcactgatgaaggacaaggagcaaagaaaaacatatcaccaccattagaatggtacaacctaccagaggggacaaaatctcttgca |
5543165 |
T |
 |
| Q |
215 |
cttgttgtggaggatattgatacaccc |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5543166 |
cttgttgtggaggatattgatacaccc |
5543192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University