View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4927_low_1 (Length: 435)
Name: NF4927_low_1
Description: NF4927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4927_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 25 - 418
Target Start/End: Original strand, 44542111 - 44542506
Alignment:
| Q |
25 |
ggtgttctctgtttctgtggttgttatgtcatcttgaggttcatcctctgtttctgtggttgttagtccttctcgaggttcatccttctcttcctctccc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44542111 |
ggtgttctctgtttctgtggttgttatgtcatcttgaggttcatcctctgtttctgtggttgttaggccttctcgaggttcatccttctcttcctctccc |
44542210 |
T |
 |
| Q |
125 |
gaagattcttcagcaactgcgttttcatttgatgatgatgcactttctggatgggagtggtcagagaaggcaatttcctgatgatggaagcaagtattac |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44542211 |
gaagattcttcagcaactgcgttttcatttgatgatgatgcactttctggatgggagtggtcagagaaggcaatttcttgatgatggaagcaagtattac |
44542310 |
T |
 |
| Q |
225 |
tgggctcattgtcgattttcccctcctgaaccaaattcaacatccaagttaaaggc----tatatataataaaatatcaaacagctgcatttgaataaac |
320 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44542311 |
tgggctcattgttgattttcccctcctgaaccaaattcaacatccaagttaaaggctatatatatataataaaatatcaaacatctgcatttgaataaac |
44542410 |
T |
 |
| Q |
321 |
tataatgaaggatatgaattaccagaatcaatggttgttcagagagcaactcaaaggaactaattgtcttggtgcactcattggatgtcaaacaactg |
418 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44542411 |
tataatgaagg--atgaattaccagaatcaatggttgttcagagagcaactcaaaggaactaattgtcttggtgcactcattggatgtcaaacaactg |
44542506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University