View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4927_low_13 (Length: 287)
Name: NF4927_low_13
Description: NF4927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4927_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 48451779 - 48452046
Alignment:
| Q |
19 |
cgcatgtctcgctctacagtacattaaggcataccagggtgattgtggtgctgtgggtggatctgatgccaagaagccccctgaatctcaatttgctgaa |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451779 |
cgcatgtctcgctctgcagtacattaaggcataccagggtgattgtggtgctgtgggtggatctgatgccaagaagccccctgaatctcaatttgctgaa |
48451878 |
T |
|
| Q |
119 |
gcttttgccccaaactgtggtgttaaggcatcaactcttgctcgtataactggtcgtttcttggggtgccagactaagtatgtccatgcacctgaggcgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451879 |
gcttttgccccaaactgtggtgttaaggcatcaactcttgctcgtataactggtcgtttcttggggtgccagactaagtatgtccatgcacctgaggcgt |
48451978 |
T |
|
| Q |
219 |
tttctgaaatcctgataagaaacgagaagagcttagacatactctacagtaagaatcacactcaggtc |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451979 |
tttctgaaatcctgataagaaacgagaagagcttagacatactctacagtaagaatcacactcaggtc |
48452046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University