View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4927_low_17 (Length: 237)
Name: NF4927_low_17
Description: NF4927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4927_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 32 - 220
Target Start/End: Complemental strand, 40343069 - 40342881
Alignment:
| Q |
32 |
tcatctaagtaactagtgattttttggtgcccgtaatgtaaaccaagtctcagatagcgattgacatgttatgcatctccctatagtgtcaaattgaaat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40343069 |
tcatctaagtaactagtgattttttggtgcccgtaatgtaaaccaagtctcagatagcgattgacatgttatgcatctccctatagtgtcaaattgaaat |
40342970 |
T |
 |
| Q |
132 |
caaatggtgtcattgctgaagggcatatttatataatggaaatgctagatagtacagtaacaattaatgtatgtttagattgatactta |
220 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40342969 |
caaatggtgtcattgctgaaggacatatttatataatggaaatgctagatagtacagtaacaattagtgtatgtttagattgatactta |
40342881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University