View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4927_low_18 (Length: 233)
Name: NF4927_low_18
Description: NF4927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4927_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 7856817 - 7857030
Alignment:
| Q |
1 |
aattatgcacattattagttgtaatgtatggacaatataatactctcnnnnnnnctttgtatgaaacaagtatcatttctacgtaattgcaaaggttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
7856817 |
aattatgcacattattagttgtaatgtatggacaatataatactctttttttttctttgtatgaaacaagtatcatttctacataattgcaaaggctaat |
7856916 |
T |
 |
| Q |
101 |
atcacgagtcgagtatgagcgtaatgaatgnnnnnnnctctatctcaaaatttaacattgttgtattttcatgagtacatctcaaaagaactctgattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7856917 |
atcacgagtcgagtatgagcgtaatgaatgaaaaaaactctatctcaaaatttaacattgttgtattttcatgagtacatctcaaaagaactctgattaa |
7857016 |
T |
 |
| Q |
201 |
attaaggagggtgt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7857017 |
attaaggagggtgt |
7857030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University