View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4927_low_9 (Length: 350)
Name: NF4927_low_9
Description: NF4927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4927_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 16 - 332
Target Start/End: Original strand, 31528315 - 31528631
Alignment:
| Q |
16 |
atgtcgatgttgagagctgaaaccaatacacatgaagatgcccaccagacagagtttagtatttgaatccatttgacttgctgaacaagcaaagaaactg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31528315 |
atgtcgatgttgagagctgaaaccaatacacatgaagatgcccaccagacagagtttagtatttgaatccatttgacttgctgaacaagcaaagaaactg |
31528414 |
T |
 |
| Q |
116 |
ttatagatatccaaatgattcctctgataatgcaagctaaccagcttagctccttagagttaccagttttgtctaagagattccaaaatccagtggcaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31528415 |
ttatagatatccaaatgattcctctgataatgcaagctaaccagcttagatccttagagttaccagttttgtctaagagattccaaaatccagtggcaaa |
31528514 |
T |
 |
| Q |
216 |
atatgcaatgctagtaaaagcacaacagattgagacaagtgagaaaatccaactttttgtctggctcttatttgcggaagttgttctggttaaactgata |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31528515 |
atatgcaatgctagtaaaagcacaacagattgagacaagtgagaaaatccaactttttgtctggctcttatttgcggaagttgttctggttaaactgata |
31528614 |
T |
 |
| Q |
316 |
gccaaggacgtgtagta |
332 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31528615 |
gccaaggacgtgtagta |
31528631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University