View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928-Insertion-18 (Length: 201)
Name: NF4928-Insertion-18
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928-Insertion-18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 8 - 201
Target Start/End: Complemental strand, 371404 - 371211
Alignment:
| Q |
8 |
agaagaaattttttgtagaaaggaatttaagtggagaagagagctttttgggcggagatagattagtgtggggagaggacccgtcgaattgccattcctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
371404 |
agaagaaattttttgtagaaaggaatttaagtggagaagagagctttttgggcggagatagattagtgtggggagaggacccgtcgaattgccattcctt |
371305 |
T |
|
| Q |
108 |
taaatgagcttataaagtcttaatggaagacaacaatttgggggagcagcatcctgttaaaaatctgtgacataattcgatttcgttaaaagtg |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
371304 |
taaatgagcttataaaatcttaatggaagacaacaatttaggggagcagcatcctgttaaaaatctgtgacataattcgatttcgttaaaagtg |
371211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University