View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928-Insertion-21 (Length: 233)
Name: NF4928-Insertion-21
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928-Insertion-21 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 7 - 233
Target Start/End: Complemental strand, 55245201 - 55244973
Alignment:
| Q |
7 |
aaaagaaggtaaggaaaaagacactgtttcacatgaagatagggacacatcgtggctaccaagtactggtcctttcttttggtcaagtgaaacgaaacga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55245201 |
aaaagaaggtaaggaaaaagacactgtttcacatgaagatagggacacatcgtggctaccaagtactggtcctttcttttggtcaagtgaaacgaaacga |
55245102 |
T |
|
| Q |
107 |
gggtttcattactttttctgcttacca-tatttcatttcattgataaattcatctgatctcaaccttcacctttttctcttac-ttgtttacatcacctt |
204 |
Q |
| |
|
||||||||||||||||||||||| | || |||||||| |||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55245101 |
gggtttcattactttttctgcttgggactaccatatttcattcataaattcatctcatctcaaccttcacctttttctcttactttgtttacatcacctt |
55245002 |
T |
|
| Q |
205 |
cagctatatatcacatcaatcatcttgtg |
233 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
55245001 |
cagctatatatgacatcaatcatcttgtg |
55244973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University