View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928-Insertion-23 (Length: 156)
Name: NF4928-Insertion-23
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928-Insertion-23 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 8e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 8e-78
Query Start/End: Original strand, 10 - 156
Target Start/End: Original strand, 56492585 - 56492731
Alignment:
| Q |
10 |
aagtttgattccggtccatcattattctctggtttgcagtcaagaggtccacaggctaaccctcttgctcaagttcttgatgctttgggagagtccgtcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492585 |
aagtttgattccggtccatcattattctctggtttgcagtcaagaggtccacaggctaaccctcttgctcaagttcttgatgctttgggagagtccgtcc |
56492684 |
T |
|
| Q |
110 |
cctgcgctacttatgattcatggatggtccatgtacctgaagctgat |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492685 |
cctgcgctacttatgattcatggatggtccatgtacctgaagctgat |
56492731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University