View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928-Insertion-32 (Length: 463)
Name: NF4928-Insertion-32
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928-Insertion-32 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 436; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 436; E-Value: 0
Query Start/End: Original strand, 8 - 463
Target Start/End: Original strand, 40740917 - 40741372
Alignment:
| Q |
8 |
gtttcatatggaaccaaacaggtctctgtgatgcccttttgtcttctctatacaattttcctcgcaacccatctttggttcttgctttagtacaatattg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40740917 |
gtttcatatggaaccaaacaggtctctgtgatgcccttttgtcttctctatacaattttcctcgcaacccatctttggttcttgctttagtacaatattg |
40741016 |
T |
 |
| Q |
108 |
gtctccaaaaaccaacacttttgtttttccttggggtgaagcaaccatcacacttgaagatgttatgattctcggtggattttcagtccttggtgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741017 |
gtctccaaaaaccaacacttttgtttttccttggggtgaagcaaccatcacatttgaagatgttatgattctcggtggattttcagtccttggtgaaccg |
40741116 |
T |
 |
| Q |
208 |
gtaacactttcgctttcttctgatttgctttcaatcgaagctaaattgatcgagattcgaaggagtatgtcgaaaaacaagtccaaaaaggcagatcata |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741117 |
gtaacactttcgctttcttctgatttgctttcaatcgaagctaaattgatcgagattcgaaggagtatgtcgaaaaacaagtccaaaaaggcagatcata |
40741216 |
T |
 |
| Q |
308 |
atgcttggttaaagtttttcaaagaggggttagaagcagaaagtgacaaactttatgaaattgagcatgtgggttttctttgtttatggttatcaaggtt |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741217 |
atgcttggttaaagtttttcaaagaggggttagaagcagaaagtgacaaactttttgaaattgagcatgtgggttttctttgtttatggttatcaaggtt |
40741316 |
T |
 |
| Q |
408 |
cgtttttccttcattttccgattctgttatcgacccgcgtgtttttccaattgcta |
463 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741317 |
tgtttttccttcattttctgattctgttatcgacccgcgtgtttttccaattgcta |
40741372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University