View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928-Insertion-35 (Length: 64)
Name: NF4928-Insertion-35
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928-Insertion-35 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 8e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 7023560 - 7023617
Alignment:
| Q |
7 |
acatacgaggttcaaccattggactctgttgaatcacttctgcttttcaatttgcatg |
64 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7023560 |
acatacaaggttcaaccattggactctgttgaatcacttctgcttttcaatttgcatg |
7023617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 62
Target Start/End: Original strand, 7030951 - 7031004
Alignment:
| Q |
9 |
atacgaggttcaaccattggactctgttgaatcacttctgcttttcaatttgca |
62 |
Q |
| |
|
|||||||||| | ||||||||||||| |||||| ||| ||||||||||||||| |
|
|
| T |
7030951 |
atacgaggttgagccattggactctgctgaatcttttcagcttttcaatttgca |
7031004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University