View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4928-Insertion-35 (Length: 64)

Name: NF4928-Insertion-35
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4928-Insertion-35
NF4928-Insertion-35
[»] chr8 (2 HSPs)
chr8 (7-64)||(7023560-7023617)
chr8 (9-62)||(7030951-7031004)


Alignment Details
Target: chr8 (Bit Score: 54; Significance: 8e-23; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 7023560 - 7023617
Alignment:
7 acatacgaggttcaaccattggactctgttgaatcacttctgcttttcaatttgcatg 64  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
7023560 acatacaaggttcaaccattggactctgttgaatcacttctgcttttcaatttgcatg 7023617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 62
Target Start/End: Original strand, 7030951 - 7031004
Alignment:
9 atacgaggttcaaccattggactctgttgaatcacttctgcttttcaatttgca 62  Q
    |||||||||| | ||||||||||||| ||||||  ||| |||||||||||||||    
7030951 atacgaggttgagccattggactctgctgaatcttttcagcttttcaatttgca 7031004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University