View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928-Insertion-6 (Length: 66)
Name: NF4928-Insertion-6
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928-Insertion-6 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 9e-26; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 9e-26
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 34612493 - 34612435
Alignment:
| Q |
8 |
ataaaattaatgcttttacggatggggctattaacaaaaccagaagagtctgtaggtgc |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34612493 |
ataaaattaatgcttttacggatggggctattaacaaaaccagaagagtctgtaggtgc |
34612435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 8e-20
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 34535933 - 34535981
Alignment:
| Q |
18 |
tgcttttacggatggggctattaacaaaaccagaagagtctgtaggtgc |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34535933 |
tgcttttacggatggggctattaacaaaaccagaagagtctgtaggtgc |
34535981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University