View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928-Insertion-8 (Length: 531)
Name: NF4928-Insertion-8
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-125; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 7 - 250
Target Start/End: Original strand, 5543187 - 5543430
Alignment:
| Q |
7 |
acacccgacccagaaggtccaattgtaccgtggacatgctgggtcgtggtgaatattcctccaacaattaaaggattgccggagggattctccggcaaag |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5543187 |
acacccgatccagaaggtccaattgtaccgtggacatgctgggtcgtggtgaatattcctccgacaattaaaggattgccggagggattttccggcaaag |
5543286 |
T |
|
| Q |
107 |
aggaggagatgggtggtgaatatgctgggatcaaagaagggaacaatgatttgaaacaacctgggtggcgtggtccgaggttgcctacacatggtcatag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543287 |
aggaggagatgggtggtgaatatgctgggatcaaagaagggaacaatgatttaaaacaacctgggtggcgtggtccgaggttgcctacacatggtcatag |
5543386 |
T |
|
| Q |
207 |
gttggagtttaagctctatgccttggatgatgagcttcatctgg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543387 |
gttggagtttaagctctatgccttggatgatgagcttcatctgg |
5543430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 197 - 237
Target Start/End: Original strand, 5549372 - 5549412
Alignment:
| Q |
197 |
atggtcataggttggagtttaagctctatgccttggatgat |
237 |
Q |
| |
|
||||| ||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
5549372 |
atggtgataggtttgagtttaagctctatgctttggatgat |
5549412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University