View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_high_20 (Length: 252)
Name: NF4928_1D_high_20
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 44542273 - 44542506
Alignment:
| Q |
1 |
agagaaggcaatttcctgatgatggaagcaagtattactgggctcattgtcgattttcccctcctgaaccaaattcaacatccaagttaaaggc----ta |
96 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44542273 |
agagaaggcaatttcttgatgatggaagcaagtattactgggctcattgttgattttcccctcctgaaccaaattcaacatccaagttaaaggctatata |
44542372 |
T |
 |
| Q |
97 |
tatataataaaatatcaaacagctgcatttgaataaactataatgaaggatatgaattaccagaatcaatggttgttcagagagcaactcaaaggaacta |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44542373 |
tatataataaaatatcaaacatctgcatttgaataaactataatgaagg--atgaattaccagaatcaatggttgttcagagagcaactcaaaggaacta |
44542470 |
T |
 |
| Q |
197 |
attgtcttggtgcactcattggatgtcaaacaactg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44542471 |
attgtcttggtgcactcattggatgtcaaacaactg |
44542506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University