View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4928_1D_high_25 (Length: 242)

Name: NF4928_1D_high_25
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4928_1D_high_25
NF4928_1D_high_25
[»] chr1 (1 HSPs)
chr1 (39-236)||(26433932-26434129)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 39 - 236
Target Start/End: Original strand, 26433932 - 26434129
Alignment:
39 ttgtgtttgtgaaatgagaacctaacttgtgaataagcttgagtgggttttctgtatcaagtaaggttatactttgggattgatctcaagggttttgttt 138  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||    
26433932 ttgtgtttgtgaaatgagaacctaacttgtgaataagcttgagtaggttttctgtatctagttaggttatactttgggattgatctcaagggttttgttt 26434031  T
139 atagtcctttctggccccnnnnnnngtaacaattttggcagccttatccaatcagtttctatagtaaggggtgcatatgacttatttttactagaata 236  Q
    ||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26434032 atagtcctttctggcccctttttttgtaacaattttggcagccttatccaatcagtttctatagtaaggggtgcatatgacttatttttactagaata 26434129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University