View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_14 (Length: 321)
Name: NF4928_1D_low_14
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_14 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 3e-45; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 225 - 321
Target Start/End: Original strand, 11063088 - 11063184
Alignment:
| Q |
225 |
caagaattaaagatcaacaaccttttggacataattactaggtaagagtcatcctacttaatcagcttggttgccatttactgtttatacttctttt |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11063088 |
caagaattaaagatcaacaaccttttggacataattactaggtaagagtcatcctacttaatcagcttggttgccctttactgtttatacttctttt |
11063184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 120 - 193
Target Start/End: Original strand, 11062979 - 11063055
Alignment:
| Q |
120 |
ttttctaccttgtcacttttttagaatttttagagtattc---acatttaggcacaataatgatcaatctcgactca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11062979 |
ttttctaccttgtcacttttttagaatttttagggtattcagtacatttaggcacaataatgatcaatctcgactca |
11063055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 11062917 - 11062969
Alignment:
| Q |
24 |
ctatcatcatgcatatcaactctaaccttgctaccaaacatcagacataaatg |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11062917 |
ctatcatcatgcatatcaactctaaccttgctaccaaacatcagacataaatg |
11062969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University