View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_18 (Length: 293)
Name: NF4928_1D_low_18
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_18 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 24 - 293
Target Start/End: Complemental strand, 31528631 - 31528362
Alignment:
| Q |
24 |
tactacacgtccttggctatcagtttaaccagaacaacttccgcaaataagagccagacaaaaagttggattttctcacttgtctcaatctgttgtgctt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31528631 |
tactacacgtccttggctatcagtttaaccagaacaacttccgcaaataagagccagacaaaaagttggattttctcacttgtctcaatctgttgtgctt |
31528532 |
T |
 |
| Q |
124 |
ttactagcattgcatattttgccactggattttggaatctcttagacaaaactggtaactctaaggagctaagctggttagcttgcattatcagaggaat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31528531 |
ttactagcattgcatattttgccactggattttggaatctcttagacaaaactggtaactctaaggatctaagctggttagcttgcattatcagaggaat |
31528432 |
T |
 |
| Q |
224 |
catttggatatctataacagtttctttgcttgttcagcaagtcaaatggattcaaatactaaactctgtc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31528431 |
catttggatatctataacagtttctttgcttgttcagcaagtcaaatggattcaaatactaaactctgtc |
31528362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University