View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_20 (Length: 279)
Name: NF4928_1D_low_20
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_20 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 21 - 279
Target Start/End: Complemental strand, 23333811 - 23333553
Alignment:
| Q |
21 |
gaatgcagctgaagcagtactcccccaaagaggttgataagtttgttttatgtaattttttgctgttttgatatattgtgtcatgatttaccaggaaaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333811 |
gaatgcagctgaagcagtactccccccaagaggttgataagtttgttttatgtaattttttgctgttttgatatattgtgtcatgatttaccaggaaaaa |
23333712 |
T |
|
| Q |
121 |
tgtacacattgtcattacctcaggaactgttgttcgtgttgctgatgagctttcccttcaagagatgcgattgctgaatacatattatgcagagcttgag |
220 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333711 |
tgtacacattgtcgttgcctcaggaactgttgttcgtgttgctgatgagctttcccttcaagagatgcgattgctgaatacatattatgcagagcttgag |
23333612 |
T |
|
| Q |
221 |
accgcaactgtaagtgattttttatatgtcaactgctttctgatgaaacaatcattata |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23333611 |
accgcaactgtaagtgattttttatatgtcaactgctttctgatggaacaatcattata |
23333553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University