View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_23 (Length: 270)
Name: NF4928_1D_low_23
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_23 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 163 - 270
Target Start/End: Complemental strand, 48683243 - 48683136
Alignment:
| Q |
163 |
ggtccttcaaatcatacaacgtttgcacttttagccttctttatacaagttatgttgtatggttctgtttattatctctccatttaggaggtatcttttt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48683243 |
ggtccttcaaatcatacaacgtttgcacctttagccttctttatacaagttatgttgtatggttctgtttattatctctccatttaggaggtatcttttt |
48683144 |
T |
 |
| Q |
263 |
cttccagt |
270 |
Q |
| |
|
|||||||| |
|
|
| T |
48683143 |
cttccagt |
48683136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 24 - 107
Target Start/End: Complemental strand, 48683381 - 48683298
Alignment:
| Q |
24 |
cgaaagactaacaaagtaaaaactgtggtaatattatgtttttgctattctttggtgcatcttattagaatgcatcccacagtc |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48683381 |
cgaaagaataacaaagtaaaaactgtggtaatattatgtttttgctattctttggtgcatcttgttagaatgcatcccacagtc |
48683298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University